El català és una puta merda

Esta entrada se la dedico especialmente a Sirventes y a Boigandreau, a los que personalmente les dije que iba a escribir algo para responderles, pero también a Galahan y a Flanagan, con los que ayer tuve una acalorada discusión cibernética.

Mi libro de literatura española de segundo de BUP allá a principios de los ochenta, cuando Almodóvar aún era empleado de Telefónica y el SIDA todavía no nos jodía la vida, el año después del 23F, en el mismísimo año de la llegada al poder de González, tenía reservado el último capítulo a las literaturas en otras lenguas de España. Por supuesto, que el profesor no las mencionó ni una sola vez, pero allí estaban, como diciendo: Nosotras pertenecemos aquí dentro. Mi pervertida curiosidad me hizo toparme con el poema de Salvador Espriú, la pell de brau (la piel de toro), ese fue mi primer contacto con la llengua catalana.

A nosotros, jóvenes de la transición, por lo menos en la ciudad de provincias donde yo me crie, se nos enseñó que España era un país plural donde había nacionalidades y regiones. Esas nacionalidades tenían una peculiaridad lingüística que formaba parte de nuestro acervo cultural. Por entonces, e incluso más en las generaciones anteriores, era muy fácil que la gente estuviera familiarizada con los cantantes de la nova cançó. Qué bonito eso de Al vent (Al viento):


A nosotros se nos hizo creer que había habido una injusticia con esa parte de nuestra cultura, que había que recuperarla porque estaba en peligro. Entonces no hicimos caso ingenuamente a los primeros que, como los del Manifiesto de los 2300, ya en el año 1981, nos alertaban de la discriminación de los no catalanohablantes en Cataluña. Los suscribientes de ese manifiesto no recibieron apoyo ni por parte de los intelectuales de Madrit ni por parte del gobierno central. Así tras el tiro en la pierna de la organización terrorista catalana Terra Lliure a Jiménez Losantos, todos abandonaron en desvandada la región, se refugiaron en la vida privada o se fueron adaptando a las exigencias de los naZionalistas. Claro, también eran los años de hierro de la banda terrorista ETA, en los que a las víctimas se las sacaba vergonzosamente por la parte de atrás de las iglesias. La primera y única resistencia fuerte a la dictadura naZionalista catalana había sido derrotada con la ayuda del terrorismo catalanista. Pujol y compañía ya no tendrían oposición a su projecte nacional.

Pero de eso no nos enterábamos porque no se hablaba, o si se hablaba era de pasada y se les ponía a esos crispadores, que sólo eran oídos por grupúsculos de la derecha, el sambenito de gente franquista y anticatalana -¿os suena esa música de algo?. Para mí, por entonces bachiller, España vivía una época dorada, la transición era un éxito, éramos la admiración del mundo y yo estaba orgulloso de formar parte de eso. Eran los años de González, del paro de dos cifras, de la entrada en la CEE, de la corrupción generalizada y de mis hormonas alborotadas. Eran los años de la movida.

Ahora recuerdo con sonrojo lo que me emocionaba escuchar: “No. Jo dic no, no. Diguem, no. Nosaltres no som d´eixe món”:

Todavía me sonroja más, e incluso me da más rabia aún, por la cara de gilipollas que se me queda, al recordarme cantar:

Porque cuando yo cantaba eso, no me daba cuenta de que cuando ells deien, no (ellos decían, no )  o querían tumbar l´estaca (hacer caer la estaca) no estaban diciendo, no, o querían hacer caer la dictadura, como yo creía, en realidad decían, no a mi país y querían destruir mis libertades. 

Yo tengo algo personal contra los naZionalistas. Ellos no sólo engañaron a los que trajeron la democracia a España pensando que si se les daba una autonomía amplia serían fieles a la constitución, sino que me traicionaron a mí personalmente, haciendo añicos esa certitud de mi juventud, de vivir en una nación donde todos teníamos los mismos derechos en cualquier parte del país. El país con la mejor cultura, la mejor gente, la mayor calidad de vida y el mejor sistema de gobierno del mundo.

Gracias, Winstanley.

Carta oberta a tu

Mi amante, el historiador (1/3)

Mi no amante montañés



518 comentarios

  1. Que guay! Has puesto un video de Raimon!
    Ese que abuchearon en el homenaje a Miguel Angel Blanco cuando fue a rendir homenaje, por cantar en catalán.
    Que curioso.

    Hale, que sí, que muy bonito, que tienes un trauma como Losantos que empezó de comunista y ha acabado de taradín, como Mussolini. Enhorabuena!

    Vaya reunión de lugares comunes, tópicos y palabrería para no decir ná.

    • que yo recuerde el abucheado fue Joan Manuel Serrat, una pena y una vergüenza de cualquier manera.

      • Pues recuerdas mal. El abucheado fue Raimon al cantar una canción, en catalán, dedicada al País Vasco.

      • Te equivocas, fue Raimon, català de Xàtiva (València).

    • Nem a veure el Catala no es una puta merda vosaltre si q ho sou Visca La Independencia volem llibertat!

    • Os lo tendrias que hacer ver por un buen psicologo. El catalan no es un lengua son quatro mil: catlan, valenciano, mallorquin, el LAPAO (que solo se lo podian inventar los fascistas del PP)… en cambio el español que se tendria que llamar castelllano, porque español es un estado plurinacional de mierda, se habla en todo sudamerica. pUes a mi me parece que el mexicano o el colombiano difieren más que el catalan del valenciano. poneros gafas españoles sin cultura

      • mira vete a la mierda los catalanes somos los mejores mira si somos guais que sabemos más de una lengua no como vosotros hijos de puta tu si eres un hijo de puta maricón, vete a dar un paseo aver si te enteras hijoo hombree!!!! y que sepas que el catalán si que es una lengua i es muy antiguaa viene del latín que lo sepas asi que si no lo sabes no hables hjo de piiiiiiiiii!!!!!!!
        alaaa a pasearrr hombrree!!
        besitoss hombre guapoortttt!!!! :”’)

    • Yo discrepo con los que juegan al enfrentamiento
      Cataluña se ha rehecho como nunca y todo gracias a la democracia
      Tiene un gobierno del que dependen 300 mil funcionarios y un cultura desarrollada propia.
      Es logico que quieran plantearse un Estado
      Que hay de malo?
      Es producto de la misma democracia.
      A que viene esa amargura.
      Llamar nazis o traidores a los catalanes que quieren la independencia es una frivolidad propia de crios que no quieren aceptar la realidad

  2. Provocador, como siempre, ummm.
    Yo he tenido claro desde siempre que el catalán es una lengua “española”, es decir, de España. Tuve acloradas discusiones con gente de Madrid allá por los 80 acerca de esto. Para ellos era poco menos que una lengua de Beluchistán, donde demonios esté eso. Un español tenía que hablar en español, o sea, castellano, ¡coño! Así era muy fácil que a través del victimismo, se les fueran entregando parcelas de poder. Ahí comenzó el desarreglo de España. Durante la transición, hubo un periodo en que este país era el ideal de la libertad. Aún teníamos una ingenuidad y una buena intención envidiables. Por oposición a lo anterior, la tolerancia era infinita. Casi como en una comuna hippy. Pero exagero un poco, tal vez por la nube en la que estaba.
    Cuando se elaboró la constitución, los nacionalistas fueron arrancando, poco a poco, cachitos de poder, ergo presupuesto, para construir sus ínsulas de Barataria. Como indico más arriba, la actitud cateta de España se lo puso fácil. (Leete Una estrella llamada Henry de Roddy Doyle sobre este proceso en Irlanda para ver cómo funcionan los nacionalistas). Llevaron al Estado por donde ellos quisieron. Ahí tenemos hoy los resultados. Y me temo que esto es irreversible, si no, veánse los resultados electorales en Cataluña.
    Muy provocador. Yo aprendí catalán gracias a Lluis Llach. Me resultaba fácil al ser tan próximo al castellano. Ahora parece que la distancia es de años luz.

    Raimon cantaba en valenciano de Xátiva. Ante los pancatalanistas que lo definían como catalán del sur él los llamaba valencianos del norte. Pero era otra época y ahora es más catalán de la Moreneta gracias a los blaueros de Valencia.

    Después de pasados los años, creo que una actitud coherente de Jiménez Losantos y cia hubiera sido dar la batalla en Cataluña. Lo de ahora, suena más a rabieta. En la Comunidad Valenciana se intentó algo parecido y se les paró los pies. Eran los tiempos de Lerma, en los que no se recataban en minusvalorar als castellans (la mayoría) en beneficio dels valencians i els catalans. Y funcionó.

    Así que entre catetos se ha cocinado ésto. Y el resultado es una bazofia que ni los perros la quieren.

    Coda: Flanagan, tienes toda la razón. Fue una falta de respeto. Habla en cristiano, ¡coño! polaco de mierda. ¡Vaya tela!

    • Meteos a vuestra Puita España, por donde os quepa, pandilla, de vagos, vividores, terroristas, chatajistas, asesinos, estafadores, difamadores, inútiles, subnormales. imbéciles, sanguijuelas, discapacitados, sobre todo BUIRROS, incompetentes, impresentables, degenarados, sois la escoria de la Raza Humana, sois la Verguenza Nacional del Mundo libre, fascistas, inquisidores, chulos, maricones, analfabetos, estais en el último eslabón de la condición humana, sois torturadores, opresores, sois la crem de la crem de la…..MIERDA…en su máximo exponente, pero temblat hijos de la gran puta, lo que tomasteis por las armas, por las armas vais a devolver, hay una guerra permanente y el dia que explotemos, lo de Yugoslavia, va a parecer un juego de niños, os vamos a exterminar, de nuestra tierra, no va a quedar ni el recuerdo de vosotros, los españolitus, ni de ninguna etnia, que no sea la nuestra, os vais a enterar, moros, cristianos foráneos y toda gente de mal vivir, no vamos a dejar en poié, ni joven, ni anciano, no va aquedar nada, el estatut os lo podeis meter en el Culo Constitucional, se acabaron el que nadie fuera de nuestra tierra, tenga que decirnos que podemos o no podemos hacer, os vais a enterar

      • Juanito, desgraciado, soy castellano, y no comulgo con la rojigualda, ni con tu puta bandera de rayas. Deja de mirarme el culo y mirate tu ombligo: mossos que TORTURAN y pegan palizas a inmigrantes, políticos de derechas que usan el nacionalismo para comerle el tarro a cenutrios como tú, igual que el nacionalismo patrio se encarga de desquebrajar los cebrebros de la patria grande. Desgraciado, ¿me conoces?Soy castellano, como vengas con tu odio a tocarme los cojones te largo de aqui a patadas, retrasado, hipócrita, si criticas el imperialismo castellano, ¿de qué vienes tu a conquistarme a mi?Nazi de mierda, retrasado, voluble, cerebrin, y toda la ristra que nuestro amigo nos ponía de insultos en catalán. Respeta, berberecho, cacique cabron, y deja a los castellanos que no son soberanistas como tú, que no todos somos his de puta, que a muchos nos la suda tanto cataluÑa como castiella, mamón, pero tu no vayas insultando a ningún lado, ombliguero, que se te cae el pelo de lo tonto que eres. Tu odio ciega lo poco de integigencia que puedes tener, seguro que eres uno de esos burros que os ponéis en el trasero de los coches, lamentablemente yo no soy ningún toro, soy un hombre libre, pero gentuza como tú no ha de insultarme, y menos ilustrarme, porque me sirves apra limpiarme el culo, igual que los facciosos de la rojigualda y el brazo en alto,lo que pasa que muchos de vosotros, catalistas de izquierda, sois más fascistas que el bajito con bigote y voz de niña. Desnutrido cerebral, guardate en tu masía porque con lo que eres no vas a ningun lado, juanito, joanito, como quieras darte a llamar, becerro, borrego, seguidista, naZionalista, patriotero de pacotilla, a mi ni tu bandera ni la grande, limpias vuestra persdonalidad de mierda en vuestros trapos, pero no generalizes, general, que se te va de las manos, retrasado.

      • Juanito, desgraciado, soy castellano, y no comulgo con la rojigualda, ni con tu puta bandera de rayas. Deja de mirarme el culo y mirate tu ombligo: mossos que TORTURAN y pegan palizas a inmigrantes, políticos de derechas que usan el nacionalismo para comerle el tarro a cenutrios como tú, igual que el nacionalismo patrio se encarga de desquebrajar los cebrebros de la patria grande. Desgraciado, ¿me conoces?Soy castellano, como vengas con tu odio a tocarme los cojones te largo de aqui a patadas, retrasado, hipócrita, si criticas el imperialismo castellano, ¿de qué vienes tu a conquistarme a mi?Nazi de mierda, retrasado, voluble, cerebrin, y toda la ristra que nuestro amigo nos ponía de insultos en catalán. Respeta, berberecho, cacique cabron, y deja a los castellanos que no son soberanistas como tú, que no todos somos his de puta, que a muchos nos la suda tanto cataluÑa como castiella, mamón, pero tu no vayas insultando a ningún lado, ombliguero, que se te cae el pelo de lo tonto que eres. Tu odio ciega lo poco de integigencia que puedes tener, seguro que eres uno de esos burros que os ponéis en el trasero de los coches, lamentablemente yo no soy ningún toro, soy un hombre libre, pero gentuza como tú no ha de insultarme, y menos ilustrarme, porque me sirves apra limpiarme el culo, igual que los facciosos de la rojigualda y el brazo en alto,lo que pasa que muchos de vosotros, catalistas de izquierda, sois más fascistas que el bajito con bigote y voz de niña. Desnutrido cerebral, guardate en tu masía porque con lo que eres no vas a ningun lado, juanito, joanito, como quieras darte a llamar, becerro, borrego, seguidista, naZionalista, patriotero de pacotilla, a mi ni tu bandera ni la grande, limpias vuestra persdonalidad de mierda en vuestros trapos, pero no generalizes, general, que se te va de las manos, retrasado.
        Además, tanto que usas el latin, como supongo usarás el catalán, espero que mejor que el castellano, descerebrado ignorante, el catalán proviene también del latin, yo lo considero lengua, y la respeto, cosa que a nazionalistas sin cabeza como tu no hacéis con mi bellísimo idioma, cabestro, burrico, desalmado, tonto, idiota, muerdevejigas. Vete a comerle la polla a tu político nacionalista, a ver cuando seáis independientes, cosa con la que no esoty ni a favor ni en contra puesto que defiendo el derecho de los pueblos a expresarse, a ver si cuando seais independientes no tienes que salirte al extranjero por ser perseguido por los mismos que votaste, fascistas engreido, estúpido, amuermado, autista de la inteligencia, malechor…

      • No he terminado ni de leer tu mail.
        me pareces mas fascista que Musollini.
        Te veo mal, chico. Para mi eres una persona ansiosa, llena de odio y de problemas, que ha encontrado en el catalanismo la excusa perfecta para expulsar sus demonios.
        No mereces ni que te lea.
        Cuando te cures, me buscas y hablamos de lo que son las personas, las regiones y los paises.
        Mientras, vete al medico.

    • “Jo canto en català i ho faig a la manera de valència”.

      Ovidi Motllor, català d’Alcoi.

      No existeix el pancatalanisme. Existeix l’opressió imperialista espanyola i prou.

      • aajajajajajajajajajajajaja opressió!! me meoooo!!!! qué nazi-onalismo más ridículo….no sabía que en Cataluña estabais tan exacerbados….Tendría más sentido en Galicia y País Vasco, donde nos dieron más por culo durante más tiempo…y ni aún así se podría hablar hoy en día de opresión….opresión……eres español aunque no lo quieras…..generaciones y siglos de historia te hacen español….y ciudadano del planeta , que es más importante…………ese nacionalismo de mierda va ayudar a cambiar el mundo que te cagas, sí, sí. Defender el idioma y la cultura es necesario, levantar fronteras y defender el chovinismo es de retrasados.
        Lo mismo le dedico a Juanito…

      • Mira Manolo de mierda me cagon tu puta madre, sabes que pasa? que nosotros los de cataluña estamos manteniendo a media españa y claro si marchamos de españa pues os quedareis mas pobres de lo que soys porque haceis MANIA MANIA MANIAA!!!!!!!!!!! Que das mas pena que rahoy y mira que ese hace pena bua es que si conseguimos la indepencia os vais a quedar en la puta ruina de los putos que soys, asi que no me toques lo que no suena porque si no sonará

      • Manolo Esobar que sepas que no tienes razón porque los catalanes queremos la independència porque nos la quitarón hace muchos años i también por que nos han quitado mucho dinero, y ahora no digas que somos tacaños porque los tacaños soys vosotros que no nos devolvéis el dinero a si que………… vete a la puta mierda cabrónnn que no eres nadiee asiii que callate hombreee pesaooo y comeme el ****!!!!!!!!…….. eeee pero con respetoo ehh no quiero mal rollo guaportt!! :”’)

    • El catalán es una lengua andorrana porque es la lengua oficial del estado libre de Andorra.
      Pero también se habla en el estado español, francés e italiano (por la ciudad del alguer, en Cerdeña). Por tanto la lengua catalana seria una lengua española, francesa e italiana. ¡Todo menos catalana!,…¿no?.

      • El único nazionalismo rídiculo es el nespañol. Por ser aliados de los nazis y por defender una nacióin que no existe. Existe la lengua castellana pero llamarla española es un inventop de 1713 con la fundación de la RAE,…pobre inculto lobotomizado por los españolitos fascistas de siempre.
        Quié poco sabes de la opresión de Catalunya, tanto como te jode nuestra existencia,…
        Nadie levanta fronteras en Catalunya esto es una invención de las derechas estúpidas españolas para desacreditarnos (cosa de la que tú todavía no te has enterado).
        España no existe. Es un invento, lo que existe es el nacionalismo español pero no la nación espoañola ni la lengua española (es la castellana, ¡entérate! que no sabes ni en que lengua hablas ni en qué país vives) tu eres castellano y yo catalán y esto no siognifica levantar fronteras ni quererte menos ni que te sientas excluído, pobrecito, si no puede prohibirnos hablar en catalán se siente excluido, pobre españolito.

    • Deberia volver a la escuela un poco de educación y respeto no te iria mal. Has adquirido los típicos vícios fascitas sabelotodos y imperantes.
      por cierto, el catalán és una lengua igual o más antigua que el castellano, porque se hablaba en castilla y el español no és una lengua y si es un estado de mierda.

  3. Este post va a traer cola.

    • Hola hijo de la gran puta, me estoy cagando con tus vivos y tus muertos,. porque eres una mierda, fisica y mentalmente, tú, no puedes juzgar nada, ni valorar nada de los Catlanes y mucho menos de Cataluña, mira que te escribo con la lengua del Hijo de la Gran Puta del Cervantes. menuda mierda esteparia, de Castilla, desgraciados de mierda, que sabeis volver a casa, porque vuestros zapoatos saben el camino, que si no, estarias perdidos, en el desierto de vuestra ignorancia, los catalanes estamos hasta los cojones de vosotros, como puede ser que unos imbeciles, subnormales, que no sabeis ni quien es vuestra madre y muchos menos el padre, a lo mejor cualquier morillo desperdigado por la alcarria…..jajajaja, que no sabeis que es el trabajo, la iniciativa, ni las ideas, no teneis mas qeu vuestro CABESTRO al que llamais toro?…desgraciados, vosotros no llegias ni a la categoria de mierda, sois pura…….diarrea….jajajaja, vuestro padre es erl cabestro de Fernando y la acémila de la puta de Isabel, bueno en honor as la verdad, ni pa puta servia…..jajajajaja, en fín es que aburriis, sois tan tontos, tan burros, tan gilipuertas, tan enanos, tan…tan..españolitus….jajajajaja…la reserva espiritual de occidente y de papa el Sapateru…jajajaja…i de monaguillu……el desgraciuao gallego de turno en este caso….Rajoyus bulgaris diarreiqus….jajajaja….en fín una gozada.
      Como catçolicos practicantes de la encomienda del Santo Ojete, que os den por el reverndisimo Culo…jajajajajaja.
      Pero que bueno soy….partida de maricones….,jajajaja…no me mereceis…jajajajaja

      • jajajjaajajajjaajaja

        Chico, !cuánta mierda en un parrafillo!

      • aajajajajajajajajajajaja aajajajajajaja dios , eres muy gracioso….pooor cierto….quizás, quizás..deberías revisar tu árbol genealógico, sabes? porque es posible que encuentres a algún “medio morito”, o incluso, romanos, griegos , suevos, fenicios, incluso visigodos! uy cuidado, que a lo mejor encuentras algún cromañón! y esos no hablaban catalán!

  4. España tiene un gran problema y es que está llena de españoles.
    Cuando digo españoles meto en el bote a los de Vaconia, Cataluña y murcianos.

    Un abrazo

    • Quizás manolo escobar debe pensar que los catalanes son igual que los franquistas nazis españoles.

      Cosa totalmente falsa y divulgada por los neonazis de la COPE y lo que ahora llaman caverna mediática (antes era el búnquer).

      En realidad los catalanes piden libertad y respeto cosa que los nazis de verdad (los que sí lucharon con hitler y a los que manolo escobar dedicaba sus rídiculas canciones vacías de contenido) les niegan.

      Los catalanes son muy conscientes desde la escuela y desde que son pequeños que son un país de paso en el mediterraneo y que es un país de acogida pero igualmente es un país que no se deja avasallar por manolitos que les pretenden hacer callar y en caso de hablar, hacerlo en su lengua extranjera, la castellana (llamada española).

      A ningún catalán le preocupan sus orígrenes, en realidad 8 de los 10 presos independentistas tienen al menos un apellido castellano.

      Lo que los catalanes no soportan son las mentiras y las estupidezes de los manolitos que repiten como loros los mensajes de los neonazis españoles de la COPE y demás.

      Lo que seguro que no tienen los catalanes es ascendencia española, castellana sí, seguro, porque sí es una nación con una lengua, cultura y tradiciones demostrables pero ¿españa? españa no es una nación, nadie tiene ascendencia española porque españa no existe como nación salvo en la mente perturbada de los que lo escribieron en esa constitución controlada por los franquistas (y, por tanto, poco o nada democrática).
      Almenos el catalán se puede hablar, como el castellano,..pero ¿el español? no existe la lengua española, es un invento tan estúpido como las canciones del escobar (el que canta y el que escribe).

    • España tiene un gran problema y es que no es país ni es naaaaaa. una mierda pinchada en un palo que se aguanta por la fuerza bruta de un toro y no pñor la inteligencia.

  5. Pues no se, reconozco que, afortunadamente soy un ignorante en estas cuestiones, quizá porque he nacido a 300 Km de Madrid pero entendía perfectamente a mi abuela de Benifayim cuando me hablaba en su valenciano cerrado de la serrana (la mujer aprendió el castellano cuando se casó entre el 20 y el 30).

    Si tengo claro una cosa, gilipollas los hay de todos los colores, tratantes de influencia y admiración también, y consumidores de ideas geniales a los que la idea se les termina pasando de fecha, también. Esos somos legión.

    Todos hemos picado en algún momento con alguna idea que nos integraba, nos hacía parte de algo mas grande que nosotros para luego deshacerse entre nuestras manos de forma mas o menos ridícula. Es tan facil vender aire a quien necesita tanto respirar….

    Tengo la suerte de no ser nacionalista de ningún signo, de ver que hay actitudes de ellos que no me gustan un pelo y, al mismo tiempo, sentirme igualmente bien cuando canto a Llach, cuando leo en catalán (o inglés, o italiano) o incluso lo chapurreo. Tengo suerte, se que nunca me creí mejor que otros, no se si será eso.

    Si ellos (curiosa polarización, ellos/yo/nosotros) han convertido una idea de pluralidad y tolerancia en otra de pensamiento único y segregación, allá ellos, que no me llamen. Como curiosidad, no voy ni iré (si puedo evitarlo) a sentirme incómodo a Bilbao, a dejarles dinero a quienes creo que se han aprovechado políticamente de una verguenza tirando para un lado y para el contrario. Mientras el pueblo siga votando por perpetuar un sistema que considero discriminador, que no cuenten conmigo, hay muchos otros sitios estupendos en el mundo por ser descubiertos.

    Salud 🙂

    • La idea de pluralidad y tolerancia llamada españa que identifica una sola lengua, el castellano como obligatoria y prohíbe o margina a las demás, supongo. Por no decir sus signos identitarios, su política, su economía, etc.
      españa jamás ha sido plural ni tolerante. Todo lo contrario. Aquí estamos nosotros para demostrarlo y América latina para confirmarlo.
      Si te han vendido la moto con manipulaciones del tipo que siempre fue un encuentro y que a nadie se le obligó nunca a hablar en castellano es tu problema no el de la realidad social ni el de la realidad científica.
      Si tan plurales sois devolvednos la libertad que nos robastéis y entonces ya no habrán más discusiones. O ¿es que por tener libertad vamos a ser menos amigos?,…yo creo que todo lo contrario.

      • qué libertad te falta ? Si me dices dónde la viste por última vez te la busco…

    • Ellos son los españoles ¿no?,…porque catalanes, vascos, gallegos, etc. no obligan a los castrellanos a hablar su lengua en su país ¿verdad? pero españa sí que obliga a todos alo pensamiento único español y a la uniformidad cultural castellana con precedentes de dictaduras fascistas. ¿si o no?

  6. http://diariodepensador.wordpress.com/

    Esta muy bien tu artículo pero no iban por ahi los tiros en mi blog, no pienso que el catalan sea una mierda, lo que me da coraje es el tipico catalanista que se vanagloria de ello y habla en catalan allá donde vaya y si le preguntas en castellano (que sabe hablar perfectamente) te contesta en catalan y toda la pesca. Igual que si fuera un gallego o un vasco o un mayorquin o quien sea, en un pais donde el idioma oficial es el castellano y para mas inri fuera de cataluña, debes dirigirte a los oyentes en español.
    Otra cosa es el tema de los nombres, respeto que no se traduzcanigual que no se traduce software, firewall, firewire, hardware…

    • Tu sacas a relucir la excepción que confirma la regla. Tambi´´en podría decir yo, con la misma estrategia, que todos los españoles son unos cabezas rapadas neonazis que apalean emigrantes y acuchillan a independentistas.
      Esto es coger la parte por el todo y por tanto ni yo pienso esto de todos los castellanos ni lo que tu dices es cierto.

  7. Un post muy bueno…
    Quien usa la cultura como arma arrojadiza demuestra que aun está extra limes. La civilización es otra cosa…
    Saludos y Libertad!

  8. EL fin siempre justifica los medios… la cuestión es, qué fin defiende cada uno y qué medios ampara…
    Saludos y Libertad!

    • Eso es peligroso. Franco hizo una guerra para salvar el liberalismo económico de la patronal contra las “hordas rojas” que accedieron democráticamente al poder y para salvar la unidad de españa (dividida, según su ideológo Primo de Rivera, por los partidos, los nacionalismos y la lucha de clases). ¿Gracias al fin de salvar la unidad de españa debió permitirse un golpe de estado, una guerra (para robar al pueblo) y una alianza con los nazis de Hitler y los fascisos de Mussolini?

  9. Hola Pennyless,
    He vist que m’has deixat una cagaradeta al meu blog i l’he haguda de netejar.
    Mira, merdetaseca, que et vagis divertint escrivint collonades d’adolescent fascistoide al teu blog , passa, però que vagis a cagar-te a les portes d’altra gent, no toca.
    Aquí ja perds el gran sentit de l’humor que demostres tenir, i passes a la categoria de porquet fastigós.

    Amb gentussa com tu, Espanya es farà cada cop mes petita i menyspreable. Quina llàstima!

    Ja que tu no tens solució, considera la possibilitat de fer-te la vasectomia.
    Pensa-hi. Em temo que ets irrecuperable, però mai no és tard. Llegeix l’obra 1984 de George Orwell…

    I que et posis ben malalt !

  10. Ninguna lengua es una puta mierda y no tengo nada personal contra los naZionalistas aunque tan indeseables me parezcan los que hablan catalán como los que se expresn en español.

  11. Al meu blog també has deixat un comentari. En preguntes si per mi el català és una puta merda. No sè perquè m`ho preguntes. Jo em considero catalana i la meva familia és catalana.

  12. Ah – i també ho he netejat.

  13. Flanagan:

    He intentado explicarte con un entrada desde el fondo de mis experiencias y de mis sentimientos por qué para mí el tema de los nacionalismos y, sobre todo, de las lenguas vernáculas, es tan importante.

    Siento que no hayas cogido, o más bien, no hayas querido coger el sentido.


    En fin, usted siempre tan prolijo y tan sustancioso. Estupendas sus apreciaciones.

    Por cierto, no se crea que me he olvidado de ciertas deudas que tiene usted con el lectorado de esta bitácora. Vosté ja sap que la pela és la pela i en este caso la pela es el contar las historias de la mili…


    ¿De verdad? Pues no sería mi intención.


    Cada comentario que me haces, estamos más cerca.

    Diario de bonsái:

    Bienvenido a mi bitácora.

    Ese tipo de estúpido no me ha salido a mí al paso nunca. ¡Qué suerte la mía! Pero entiendo tu malestar.

    Yo soy Hayek:

    Totalmente de acuerdo. Ahora, el fin justifica los medios…Ay, Dios mío, con la Iglesia hemos topado.


    Benvingut a casa meva.

    És una llàstima que no m’hagis deixat una adreça de pàgina electrònica o de correu electrònic vàlid, m’hagués agradat conèixer-te més.

    No em sol agradar la gent tan escatológica com tu, la veritat, però hagués fet una excepció amb tu de bon tros gust, perquè m’has donat una recomanació cultural i altra mèdica. Això no passa tots els dies.

    La teva recomanació cultural no és necessària, perquè el llibre de Orwel ja m’ho he llegit. Ja que estem recomanant llibres de Orwell, què tal si li fas un cop d’ull a Homenatge a Catalunya. Aprendràs un poc de la història del nostre país i com els nacionalistes i els d’esquerres ho varen fotre al camp, guapet.

    Bueno, quant a la recomanació mèdica, tampoc és necessària -per descomptat, quin dia duus avui, nen?-Sóc marieta i mai tindré fills. No obstant això, he de donar-te una dolenta notícia: Tinc nebots i a tots els vaig a transmetre el meu amor pel nostre país, Espanya, en el qual s’inclou també la regió catalana.

    Bueno, majo, que et vagi bonic. Ah, quant al meu dolor. Em palpo, em palpo, em palpo. Ho sento, nen, no em dol gens.

    Potser en altra ocasió. Adéu, guapet.


    Bienvenido a mi casa.

    Tus palabras son bien claras.


    Benvinguda a casa meva.

    Ja sé que creus que el català no és una merda, faltaria més.

    M’hagués agradat que haguessis comentat l’entrada en la qual parlava sobre els naZionalistes que tenen sojutjada Catalunya i els catalans no catalonoparlants.

  14. Et comento des d’aquesta adreça perquè no sé com fer anar la de rojisimos per respondre.

    No comparteixo gens ni mica la teva visió arran dels nacionalismes, que mai escriuria amb Z, perquè hi ha de tot, però a espanya nazis sols trobarem a Democràcia Nacional i algú al PP (els que s’escoren més a la dreta).

    Del teu comentari et diré que ara toca Zaplana perquè ha marxat, i la conversa perquè està corroborada, els altres casos no ho estan o no hi ha suports.

    No haig d’esborrar cap comentari de ningú mentre no facin dues coses:
    -Fer spam o vindre a fer propaganda d’altres webs.
    -Faltar al respecte dels autors de la web (som dos) o dels comentaristes.

    Petons, vermells!!!

  15. Buen titulo para atraer la atención.
    El problema del nacionalismo catalán, como muy bien señalas, es que tiene un pecado original: la traición.
    De lo vivido en estos 30 años largos se deduce que jamás existió la menor intención de “garantizar la enseñanza en la lengua materna”.
    Yo también era bachiller por aquellos tiempos, Franco murió el año que llegué a la Universidad. Personalmente participé en las movilizaciones por la Llibertat, Amnistia i Estatut d’Autonomía desde la organización política que existía y también desde la Assemblea de Catalunya, donde participé en el grupo de lucha no violenta con Xirinacs, Colom y otros.
    Jamás pensé que a mis hijos les iban a negar el derecho que yo defendí para los suyos.
    Ese pecado original, de traición insisto, empapa todas y cada una de las actuaciones del nacionalismo catalán.
    Quizás llegue el día en que se den cuenta de que no es violando derechos como se defienden derechos. No me refiero a los nacionalistas sino a los ciudadanos.
    Pero no soy optimista, el veneno de la traición es muy poderoso.
    Por cierto: yo sigo defendiendo el derecho de todos los niños a recibir su primera educación en su lengua materna. Llámame bobo, pero uno tiene principios.

  16. No conozco la época de la que hablas, conozco el presente, y tampoco soy nada nacionalista.
    Sólo pienso que todas esas ideas son para comerle la cabeza a muchos y hacerles creer que por ser de un sitio o de otro son mejores, y yo digo que una bala en el craneo deja tonto tanto a catalanes, como a españoles. Tengamos dos dedos de frente, y pensemos por nosotros mismos.


  17. Hola:

    No puedo pensar que un idioma/dialecto sea una puta mierda. El problema es como han usado los nacionalismos el catalán como arma de defensa de sus valores y lo usan para obstaculizar al que no piense de su misma manera.

    ¿Y cómo lo han conseguido? Pues usando a los gobiernos más débiles, yo te doy la llave del poder a cambio de que me dejes hacer cosillas por mi tierra. Y ahora están muy subidos y son difíciles de parar.

    El catalán no es una puta mierda, son una puta mierda quienes pretenden imponer un idioma amparados en una falsa pluralidad.

    Un saludo desde Diario de un Bravido”

    • En catalunya no se impone el catalán, se habla catalán (de ahí el nombre). La única lengua impuesta en Catalunya es el castellano con el alias de español para hacer creer que es de allí sin ser verdad. Y se impuso siempre desde 1714 hasta 1975 por la violencia y no “porque a nadie se le obligará nunca a hablar en castellano sinoi que fueron los pueblos más diversos los que acogieron el idioma de cervantes”.

    • El catalán no es la lengua de Indonesia, es la lengua de Catalunya.

      • Los catalanes no imponen la lengua catalana en Madrid y Sevilla. Pero los españoles sí imponen el castellano (alias español) en Catalunya.

    • Los que son una puta mierda son los imperialistas que pretenden imponer el pensamiento único y unificar bajo su mandato a todos los peninsulares (excepto Portugal) y, para ello, no dudan en imponer sus tradiciones (toros) y su lengua (castellano) y hasta cambiarle el nombre (español) apropiandose de un término que era de todos y ahora solo es suyo (españa).
      Los que son una puta mierda son los que disfrazan el imperialismo de falso internacionalismo.

    • Los que son una puta mierda son los que nos venden el castellano con un falso paternalismo invitandonos a abandonar nuestra lengua y si no lo hacemos, encima, los nazis somos nosotros. (Nazis desde que lo dijo Losantos, porque antes erámos judíos y polacos). ¿qué será lo próximo que nos llamaran si no volvemos a someternos?.

  18. Vaya memez de post!!
    Lo único que haces és reiterar ya los ultaminoritarios y cansinos argumentos de partidos como UPyD y Ciutadans que ambos juntos cosniguieron la incrïble cifra del 1% de votos en las pasadas generales en Catalunya.
    Eso si, en la Madrid faha y casposa de Espranza Aguire y Telemadrid estos agumentos proimperialistas arrasan, vendiendouna imagen dictatorial del nacionalismo catalan que nada tiene que evr con la realidad y que lo único que a onseguido és catapultaral PSC a su mejor resultado en su història y marginar al PP catala al lugar que le corresponde: el ostracismo

  19. No sé que pretens amb una pregunta com aquesta.Per ventura has llegit un sol escrit en el meu bloc que d’entendre que tinc aquesta opinió del català o dels catalans?.

    Et pregaria que si vols entrar i opinar en el meu bloc t’abstingueres de portar merda al mateix. Ací s’admet l’opinió a favor o en contra de qualsevol tema, no estic disposat a entrar en el menyspreu i el desprestigie de ningú; això queda per a tipus com Losantos, Aznar o la teua admirada Rosa Díez.

  20. Que pena me das perdiendo tanto tiempo y gastando tanta preocupación en “solucionar” un “problema” como es el catalán y le dediques tal parrafada pseudointelectual, además del trabajo que supone entrar a otros blogs a dejar comentarios difundiendo tus pesadillas. Eso, dedicadle tiempo a pensar en el catalán que así los otros temas importantes de España los dejáis de lado y así nos va a ir. Quizás el problema lo tienes tú y unos cuantos como tú.

  21. Gazzpatxo:

    Tu saps que no m’importa que treguis els draps bruts de gent del PP. Et creuré més, quan treguis els de gent del PSOE també. Si no, tot em sembla de riure.

    Petons, petons, del color que siguin.


    El título está causando furor entre el lectorado català, jajajajajaja.

    Exactamente. Y tú lo has vivido. Si yo estoy decepcionado que soy un poco más joven que tú y no participé en esa lucha, pues me imagino lo que sentirás tú. Me atrevo a decir, si me lo permites, que para ti también ha sido una traición personal, no sólo a tu país, sino a ti, como persona.

    Lo que dices de tus hijas es impresionante. Cómo la gente se convierte de víctima en verdugo en cuanto le dan la posibilidad. Eso nos dice mucho de la especie humana, no sólo del homo hispanicus.

    Es verdad: El veneno de la traición es muy poderoso. A mí, lo que todavía me fascina es la gente como Montilla. Cómo se pueden mirar a la cara todos los días y no pegarse un tiro. ¿En qué idioma le hará los cariñitos Montilla a sus hijas? ¿en català? Lo dudo. Y la gran masa de trabajadores castellanohablantes ¿de verdad que son tan tontos de culo que se dejan rebajar a ciudadanos de segunda en su propio país? Para mí, es todavía incomprensible.

    Yo, sin embargo, soy un poco más optimista que tú, la pela és la pela, nen.

    Que sigas defendiendo la enseñanza en lengua materna, es lo moral y lo justo, no es lo bobo.


    Totalmente de acuerdo. No votemos PSOE o naZionalista nunca.

    Kin El Bravido:

    Bienvenido a mi casa.

    Claro que el catalán, ni ninguna lengua son una mierda. Con los naZionalismos se han convertido en arma arrojadiza, y en objeto del odio de muchos.

    Pienso que por estas imposiciones, en cuanto haya verdadera libertad, la gente va a pasar muy mucho de usarlos. En el fondo los naZionalistas lo saben, por eso la mano dura de hierro.

    Arqueòleg Glamurós:

    Bienvenido a mi casa.

    Bien sabes que lo que dices es falso. Tú puedes ser glamuroso, pero no tonto.

    Esa imposición y es dictadura naZionalista existe. Pero algún día acabará.

    En cuanto al PSOE. Este ha recibido los votos de los independentistas de todas las regiones bilingües, no de los castellanohablantes. El PP ha mejorado. Ciutadans ha sido un fracasillo, pero espero que se recupere. UPyD va a ser el Pepito Grillo y azote de los naZis en el congreso. Ya lo verás.

    Pon al frente del PP de Cat a un Vidal Quadras, y os barre a todos los naZionalistes en dos elecciones.

    Saludos cordiales.


    Benvingut a casa meva.

    Sentu que t’hagis pres la meva calorosa invitació que llegeixis la meva opinió en alguna cosa tan del color marró.

    Per a desprestigiar-te no necessites ni als quals assalten a Francisco Caixa, ni als quals manen bales als pares de Rivera, ni a la pobereta Ferrusola, et bastes tu a tu mateix.

    Salutacions cordials.


    Bienvenido a mi casa.

    Yo no te puedo abrir los ojos si no quieres ver. Si te parece que los derechos lingüísticos y culturales en la España de hoy, no son un problema, entonces me gustaría qué es lo que tiene que pasar en ese terreno para que te parezca preocupante.

    Jose, este problema no lo tengo sólo yo, lo tienes también tú, aunque no quieras darte cuenta.

    • Perdona pero UPyD no puede ser el azote de los nazis puesto que, como todo el mundo sabe, Falange Auténtica le propuso a Rosa Díez de formar parte de sus filas al coincidir en todos sus postulados (o sea el fascismo de Franco, y la extrema drecha europea neonazi). Ella se negó porque los nazis están muy mal vistos en la actualidad y ahora deben esconderse bajo siglas democráticas como UPyD, Ciutadans, Plataforma per Catalunya i PP.

      Cosa muy fácil de demostrar con notícias reales en la mano sobre viedojuegos donde disparan contra emigrantes, propaganda de criminalización de los emigrantes, políticas de ultraderecha, exacerbado odio a todo lo no-castellano (alias español), etc.

      Estos son los nazis de verdad y los que mienten llamandoselo a los demás también.

      • Se tu mismi,disfruta de esta PUTA MERDA DE VIDA, y dejad a los catalanes i a los “no” hacer la nuestra; CAPULLOS !!!!!

  22. ehem… ¿”acerBo cultural”?

  23. Winstanley:

    Miles de gracias, mil veces.

  24. ahi, en tu linea, fomentando la unidad del estado y la integración de los pueblos.
    cada vez que abres la boca, haces que la gente de la periferia no solo te odie más a ti, sino a lo que tu defiendes y representas, por lo que el que no hace más que echar piedras sobre su propio tejado eres tu´.
    bonita manera de fomentar la convivencia. aunque bueno, realmente, me parece que a ti todo esto te la suda, lo unico que te interesa es fomentar la polemica. no tienes ni puta idea de lo que hablas, no haces mas que repetir los tipicos topicos manidos del pp, sin argumentarlos ni razonarlos. yo creo que montas todo este follón unicamente para incrementar el numero de visitas de blog y así alimentar tu ego. te entiendo, debe ser duro ser un friky sin amigos y la unica esperanza de sentirse reconfortado es viendo lo popular que eres detrás de la pantalla sintiendose ¿admirado? viendo como suman las visitas. pero bueno, cada uno se entreniene como mejor le gusta, es la grandeza de este pais, que de momento somos libres incluso para pensar, no como en tiempos de Jose Mari I , el unimente, lider del pensamiento unico.

  25. No conozco esas épocas porque yo aun no había nacido pero me imagino que después de años de dictadura los catalanes, como cualquier otro colectivo nacionalista, se salieron del tiesto, pidiendo derechos y libertades, convenciendo a los habitantes de las comunidades de que eso era lo mejor.
    El catalán es una lengua española, que debe respetarse tanto como el castellano, pero no debe hacerse de ella (a mi parecer) un arma para dejar al resto de españoles en K.O.
    Te hablo desde mi experiencia y bueno, yo no soy valenciano, vivo aquí por “accidente” y a mis padres les cuesta 6000 euros que yo vaya a una universidad donde se hable castellano, a mi madre le costó muchísimo encontrar trabajo y eso hablando de la C. Valenciana, mucho más moderada. Yo respeto la lengua valenciana, el catalán, el euskera, el gallego y todo lo habido y por haber, pero si piden igualdad que se ciñan a ella, seamos todos iguales. Y luego viene Z a decirnos que está de acuerdo con las multas a los comercios rotulados en castellano, aunque quisiera, no podría ser nacionalista.

    Buen artículo.
    Un saludo.

    • Igualtat és que tú aprenguis la llengua del lloc on vius a més de ser de bona educació.
      No existeix la llengua valenciana com tampoc l’argentí, el cubà o el nicaragüenc. És la llengua catalana que has de saber si vius als Països Catalans i no ets un imperialista espanyol.

    • Ah! i aquest article és una puta merda igual que el cervell de qui l’ha escrit.

  26. vamos a ver CACHIBACH85
    pues que coño os quejais del nacionalismo catalán si tu dices sufrir lo mismo, EN UNA COMUNIDAD GOBERNADA POR EL PP, en valencia ?? y tienes mas problemas que si vivieras en cataluña, eso te lo puedo asegurar, pues en cataluña el numero de andaluces y extremeños se acerca al millón y no creo que ellos tengan problemas con el idioma, la prueba es el ridiculo numero de votos que obtiene allí el pp.
    además, si vivimos en una democracia, hay respetar el resultado de las elecciones, y por lo que podemos observar, la gente prefiere a zapo, por muy malo que pueda ser, que al rajoy, así que a esperar vuestro turno, pero dejad de patalear ya como niñatos.

  27. Hola, lo de los idiomas somos unos gilipollas, intentamos siempre hablar lenguas minoritarias y si no las inventamos, o buscamos en las raices lenguas antiguas e intentamos revivirlas, somos capullos integrales, en vez de intentar hablar todo el mundo una misma lengua en l planeta para comunicarnos mejor, en vez de eso a dividirnos y fomentar la separación y las diferencias. Eso solo es bueno para la derecha, sea nacionalista o no, por que para el obrero lo mejor es entenderse en todos los sitios alos que va, y al obrero le da igual lo de los nacionalismos, el solo quiere vivir y trabajar tranquilo, le da igual a mando de unos o de otros, se llame su pais España, Cataluña, Pais Vasco o Francia. En cada región hay unos caciques que les gusta el tema ese de las independencias, solo para tocar los güevos y chupar más perras de los gobiernos centrales, pero la gente no se da cuenta de que independientes o no van a tener los mismos problemas de siempre, que con eso de las independencias no se arregla nada. El problema real son las derechas opresoras que intentan diariamente acortar derechos a los obreros para ganar rentabilidad, a costa de jodernos bien jodidos, no es el problema el idioma, si no las ideas que no las tenemos claras, divide y venceras eso es lo que está haciendo la derecha, dividir al obrero de toda España. Me importa un pimiento vivir en Cataluña, en Italia o en Aragón, mis problemas son los hijo putas especuladores de vivienda, bancos que nos invitan dan todas las facilidades para endeudarnos, empresarios que nos pagan una mierda haciendo mas horas que un reloj y nos amenazan con llevarse las empresas a otro pais, politicos que no piensan mas que en privatizarlo todo, eso son problemas y no los idiomas y tanta tontada. La lucha obrera se ha perdido en España, cada vez vamos a peor y cada vez somos mas gilipollas.

    • Absoluto y Dignificante.

    • Ciertamente, es como tu dices. Barcelona, como sabrás, fue la ciudad donde hubo más escuelas esperantistas de Europa.
      Los independentistas de izquierdas tienen como doble objetivo: Independència i socialisme con la creación de un estado facha menos y, desde allí, una vez liberados si podemos ayudar a la clase obrera castellana tanto mejor.
      Porque desde la españa burguesa e imperialista no puede haber revolución alguna y cuando la hubo, en el 36, lo primero que se hizo (ya desde el 31) era respetar la autonomía de los pueblos pero una autonomía más libre,progresista y socialista de lo que jamás dejará ser la Constitución nacida con la bénia del franquismo en el 78.

  28. Por primera vez he entrado en este blog al encontrarlo en el de Arcadi Espada de El Mundo.
    Estoy sorprendido por la mala educación y falta de respeto entre algunos participantes y ni siquiera voy a mencionarlos. En general el tema de si el catalán es una mierda o no, creo que no tiene el menor interés general. Es una mierda para unos y es el idioma del futuro inmediato para otros. Vamos, disquisiciones bizantinas que no interesan a un mundo globalizado dominado, como no podía ser de otra manera, por el idioma inglés.
    Quien no sepa inglés hoy día, ES UN ANALFABETO. Y entre ellos podemos contar con la inmensa mayoría de los políticos actuales de España. perdón, del Estado. Entre ellos, Aznar, F. González, Zapatiesta, Rajao, Zaplana, Acebes, etc, etc…
    Hace muchos años que viajo por todo el mundo como periódista, enviado especial, corresponsal de guerra -desde 1959- y si no hubiéra sido porque en mi educación infantil y posteriormente en el extranjero, aprendí inglés y francés como mi propio idioma, el español, no habría podido hacerme entender y entrevistarme con personalidades políticas de medio mundo para luego poder transcribir lo hablado para el diario El Pueblo, El País y La Vanguardia.
    Mi matrimonio con una berlinesa y mi conocimientos de tres idiomas me permitieron poder aprender alemán y aún puedo conversar en este idioma.
    Al divorciarme y contraer matrimonio con una italiana, de Verona, hace treinta y tres años, me han permitido hablar y escribir en italiano y “veneto” (dialecto veneciano) como si fuera natural de ese país.
    Ahora en España, jubilado de mi vida de trotamundos, escritor empedernido que publica en francés, español e italiano, con el relativo éxito que permite vivir de escribir, me encuentro con estas discusiones intrascentes, imagino que bien intencionadas -pero muchas veces irrespetuosas- y me congratulo de no haber vivido en España en los últimos treina años.
    Quiero agregar, para terminar esta intromisión en sus cruces de opiniones, diciendo que, efectivamente, “el catalán es una mierda” desde el momento que con este idioma no se puede ir a ninguna parte. Y diría más: También, en este sentido de la poca utilidad del español, aquí llamado castellano, para viajar por el ancho mundo, el español “también es una mierda”.
    Solo en inglés puedes viajar por donde quieras e incluso en Irán, Irak, Kenia, China, Japón, etc, etc… mejor o peor te puedes hacer entender.
    Ahora, en breve, que viajo a Jerusalem, Atenas, El Cairo y Alejandría, trataré de practicar el catalán. Veremos a donde me mandan.
    A todos, un cordial saludo.

    • Entonces aprendamos todos chino mandarín porque es la lengua más hablada del planeta ¿no?,… o el inglés porque es el idioma de la pasta,…o el esperanto que debería ser el de todos.
      Mientras tanto, los que no vamos de vacaciones, dejaremos que la gengte hable como le dé la gana sin prohibir la lengua de los demás, sin minusvalorar ninguna (porque todas han contribuído y contribuyen a la cultura universal a pesar de los defensores del pensamiento único, la dominación cultural norteamericana y el impeialismo económico neoliberal).

  29. ¡Bravo!

    Bonitas y acertadas palabras. Se aprecia que salen de corazón.

    Un saludo.

  30. Antes de todo, de ningún modo pienso que una lengua pueda “ser una mierda”.

    Soy catalán y bien de izquierdas, pero creo que es cierto que hay cierto exceso de catalanismo aquí (refiriéndome al idioma, no a la política). Creo que este tópico ha ido demasiado lejos por ambos lados:

    – Por parte de los nacionalistas catalanes, muchos defienden el catalán hasta el punto de negarse a utilizar otras lenguas y causar problemas de accesibilidad al público (muchas veces se usa el catalán a sabiendas de la existencia de público que no lo comprende)
    – Por parte de los nacionalistas españoles, muchos llegan a juzgar a personas por haber nacido en territorio catalán y a atacar cualquier relación con este idioma.

    En tu post hablas sobre el exceso de apoyo al catalán, así que me centraré en ello.

    El catalán ha sido muy atacado, e injustamente, pero tampoco hay que sobrevalorarlo. Es lo que es, una lengua hablada por 7,7 millones de personas, muy pocas comparadas con los 450-500 millones de personas que hablan el castellano, y punto. No habría que luchar por ello, ni para atacarla y mitigarla ni para apoyarla y fomentarla: la evolución natural siempre lleva a la consecuencia más próspera. La tradición sirve en memoria pero no en la práctica, como el Esperanto: dejemos evolucionar libremente al catalán, y si resulta práctico ya nos encontraremos utilizándolo en el futuro.

    Ejemplo 1: He visto, y más de una vez, a una persona que solo sabe ese idioma preguntar en castellano, y que la otra persona (aunque sepa castellano) le responda en catalán y además ponga problemas para cambiar de idioma. Estas conversaciones terminan en una discusión sobre el catalán, y ya olvidan el tema principal.

    Ejemplos varios: Tampoco tiene sentido la nomenclatura del catalán como “lengua española o no”, “lengua oficial y única o no”, considerarla un dialecto o no… Y no es necesario traducir todas las palabras en catalán, en un intento casi desesperado de implementar palabras españolas e inglesas al idioma catalán.

    Se trata de una lucha absurda sobre el catalán, en la que solo adquiere sentido apoyar una u otra postura según los excesos en las actitudes (pros y contras) de los demás. Pero, al fin y al cabo, es una discusión insustancial. Es solo un idioma: si nos sirve bien, sino utilizemos el que nos venga mejor, ya sea inglés, castellano o chino.

    Es por esto que he traducido el texto inicial de mi post del catalán al castellano: porque creo que tendrá lectores que no sepan el catalán.

  31. La próxima vez que vengas a mi blog hazlo con educación y respeto; cuando quieras vomitar mierda quédate en el tuyo o allá donde admitan tus vomitonas.
    Anda ahora ve y se lo cuentas a la Rosa.

  32. Putoloco:


    No has pillado mi intención al escribir esta entrada.

    Repasa los comentarios desde Rubén hasta Pataliebre o Pol, ellos parece ser que captaron que yo escribo de estos temas, no desde la perspectiva fría, periodística sino desde la experiencia personal y sentimental.

    Creo que este com. no te merece. Generalmente soltabas tus puyitas y tus pullitas con discreción, esta vez has querido herir personalmente. Siento decirte que conmigo tu estocada ha dado en hueso.


    Ya ves como el PP también tiene culpa -en esto Putoloco tiene razón y también nos lo recordaba Rubén– en la implementación de políticas discriminatorias. Espero que algún día el PP haga autocrítica.

    Me alegra que hables de tu madre, porque si para alguien puede entender esta entrada es gente de esa edad como Minneconjou o Rubén. Te pido que le invites a leer esta entrada. Me gustaría saber qué piensa ella. Casi, casi, puedo decir que lo escribí para que gente como ella.


    Interesante tu punto de vista.

    Es de risa ver como partidos de izquierda se han olvidado por completo de su ideología primigenia y han caído jubilosamente en las garras del naZionalismo, que es una ideología burguesa donde las haya.

    No estoy de acuerdo en ese desideratum internacionalista por el que dices que al obrero le da igual donde viva, lo que quiere es vivir y trabajar tranquilo. No. Creo que minusvaloras el papel de la identidad en las personas.


    Bienvenido a mi casa.

    Me siento muy identificado con usted al haber estado tanto tiempo en el extranjero. Yo mismo vivo fuera de España desde hace casi 15 años; sé lo que siente uno al toparse con semejantes disquisiciones paletas cuando uno ha estado por esos mundos.

    Tiene usted razón que la preponderancia del inglés es tan abrumadora que a todos los otros idiomas por muy importantes que sean los deja en “una puta mierda”. Es curioso cómo los naZionalistas mandan a sus hijos a escuelas internacionales, generalmente de habla inglesa, y no los meten en los colegios públicos unilingües que ellos imponen a los hijos de los otros.

    Por el camino que vamos y con alegatos a favor del inglés como el suyo, este tipo de discusiones serán ridículas. Dudo mucho que usted no les haya transmitido a sus hijos su lengua materna, por muy en el extranjero que estuvieran. Así que no me creo esa impostura peyorativa con respecto a su propia lengua que usted ligeramente deja entrever en su comentario.

    Dice que usted es un escritor empedernido. Eso de español tratamundos primero con señora berlinesa, pero que termina con una veneciana tiene que dar para muchas historias interesantes. Sea tan amable de mandarme algún título por CE. Me muero por leerle.


    Gracias por tus palabras. Has pillado lo que quería decir.


    Bienvenido a mi casa.

    Las situaciones que usted describe son bien interesantes. A mí lo que más me interesaría es cómo ha reaccionado usted al ver que se trataba así a alguien por no entender el catalán.

    ¿Qué hace usted cuando se usa oficialmente el catalán a sabiendas que la gente a la que va dirigido ese mensaje no entiende catalán? ¿Dígamelo usted, señor catalán de izquierdas?

    Perdone que personalice, pero es que en la imposición dictatorial de la ideología naZionalista participan personas. Al final son esas personas las que sojuzgan a los demás, no la ideología. Por eso me interesa sobremanera lo que USTED personalmente hace para detener esa injusticia. Le ruego encarecidamente lea el comentario de Cachivache98 y el comentario de Minneconjou (y para este tipo de temas, le invito a que también visite su bitácora).


    Ahora vienes de nuevo, esta vez usando la LLENGUA DE L´IMPERI.

    Parece ser que no confiabas demasiado en que la gente te entendiera, por eso vuelves a la escena del crimen.

    Muy bien, di lo que quieras. No te voy a censurar. Los demás serán libres de leerte o pasar de ti.

    En cuanto a lo de Rosa Díez. Me alegro mogollón el haberla votado. Veo que, todavía no ha empezado y ya os escuece.

  33. Bueno…
    Hoy la cabezera es atractiva, eh?

    Me parece que hay una gran diferencia entre los idiomas que mayoritariamente se hablan (el inglés), y los idiomas de cada comunidad cultural en el mundo.

    Cada lenguaje es especial y bello, ya que describe lo humano en un contexto determinado, con sus sonidos, sus significantes, describe la cultura de la gente…
    Si sólo nos quedaramos con un idioma, perderíamos muchísima cultura.

    La cultura es algo que los humanos necesitan para relacionarse y sobrevivir, arraigados a las normas, costumbres y a sus tierras.

    Leyendo algunos comentarios, creo que lo mejor para que no os metais con la gente, es la independencia de Catalunya y Euskal Herria, jaja
    A ver, con quién os meteríais? Estaríamos todos más tranquis, no?

  34. Comentario injurioso trasladado al Cubo de la basura.

  35. Bueno, ya tenemos algo en común. En Catalunya la historia de la transición también se ha vivido como la cuentas y también nos hemos quedado con el sabor a estafa.
    No acabo de ver el sentido del título del post con tu reflexión. Pero bueno, ahí esta.

  36. Mi derecho de réplica, que antes ha sido borrada de entre tus comentarios:


    Evidentemente, puedes volver a borrarlo y menospreciar la libertad que pregonas.

  37. Realment el títol i el contingut és d’adolescent facistoide. Ho sento, però no arriba ni a provocació. Caldria una mica més d’enginy, per això.
    El teu post és tan poc provocatiu que et dediques a penjar-ne enllaços als blocs dels demés. Bastant tontet, tot plegat. Al mateix nivell que “El castellano es una puta mierda”. Veus que n’és de fàcil no pensar?

  38. Bienvenido al club de los disidentes, me alegra saber que somos tantos.
    Te sigo la pista desde hoy mismo.
    A ver si uno a uno todos van abriendo los ojos a la realidad, vendas fuera…

  39. Aire:

    Como proposición humorística me vale.


    Bienvenido a mi casa.

    Hablando contigo en tu bitácora, ya sé que no es de la misma frustración de la que hablamos.


    Llavors, si no és provocativa per què aquesta ràbia tan poc dissimulada. El títol pot ser un poc així, així, però el que més t’ha molestat és l’interior.

    De tota manera, Benvingut a casa meva i torna quan vulguis.


    Se bienvenida a mi casa.

    Es verdad. Cada día somos más. Los naZionalistas no podrán destruir ni España, ni nuestra libertad.

    • La libertad es que españa desapareca puesto que es un invento imperialista. España es lanación castellana más la suma de sus conquistas peninsulares en la actualidad.

      Para que haya libertad real la nación castellana debe ser solo ella (aunque se apropie de la denominación española si tanto le gusta, para ellos) y los demás libres.

      Los únicos nazis son los que defendieron la unidad de españa on Hitler y Musolini del 36 al 39 y los que, hoy, les emulan.

      Y que, por cierto, no engañan a nadie,..antes erámos judíos y polacos, ahora, desde que lo dijo su gurú Losantos el cojo nos llaman con el nombre que define a sus padres. Mañana ¿que se inventarán?

  40. Gracias por tu visita.

  41. Ya dije que traeria cola.

  42. Comentario amenazante trasladado al Cubo de la basura.

  43. Claro que soy consciente de que el PP tiene parte de culpa, y tenía la esperanza de que, según dijo Rajoy, iban a establecer igualdad y libertad para elegir entre una educación pública en castellano o la lengua en cuestión. No estoy diciendo ahora que esté bien que se deje en el olvido la lengua propia de la Comunidad, sino que también se enseñe en castellano y que nosotros podamos elegir. Yo he podido elegir, mis padres pagan, pero hemos elegido al fin y al cabo. Sé, por amigos que tengo, que en Cataluña incluso las universidades privadas enseñan en catalán, por lo tanto, ahí está un poco más difícil la cosa. Sólo digo eso.
    Digo mi madre porque es madrileña, y al venir aquí y no saber valenciano le costó, mi padre sí nació aquí y vivió su juventud, por lo tanto sí conoce el valenciano, con él no hubo problemas.
    Creo que se identificará más con esto mi padre que mi madre, en cualquier caso luego les digo que se pasen leerte…

    Un saludo.


    Gracias por tu bienvenida y como decía ayer estoy a punto de salir de viaje y atenderé con mucho gusto tu petición de que puedas leer algo de lo mucho escrito, aunque, sinceramente, mejor que todos volvamos a echar una nueva ojeada a Cervantes, a la segunda parte del Quijote que no tiene desperdicio. Leerme a mi tiene poco interés. Especialmente las crónicas como enviado especial al haber quedado solo para las hemerotecas.
    Repito mis opiniones de la tarde de ayer: El catalán -sin mierda y mucho menos puto- es más que lógico que se enseñe, se hable en familia y sea un excelente vehículo de comunicación, especialmente para los que lo entienden. Escribirlo es otro cantar.
    Estoy en contra de toda imposición. Durante el franquísmo se obligó en toda España a hablar en español/castellano en contra de otros idiomas -entonces llamados dialectos- pero en familia se hablaba en catalán y por eso ha conseguido sobrevivir y en tertulias y “capillas” se siguió usando esta lengua patrimonio de todos los españoles y especialmente de Catalunya, Reino de Valencia y Baleares, con grandes variaciones y discusión de su “propiedad” u “origen”. Los militares y falangistas triunfantes, es verdad que obligaban, por la buenas o por las malas, a que en público todos hablaran en “cristiano” . Aún recuerdo, me lo contaron, que el inmarcesible e impresentable Pablo Porta que pistola al cinto paraba a la gente en Barcelona y les obligaba a cantar el “cara al sol” y otras lindezas.
    Por otro lado, me decía un excelente compañero, enviado especial de La Vanguardia en Austria y centro Europa, Ricardo Estarriol, que el catalán se entiende con gran facilidad. Solo hace falta un poco de buena voluntad por ambas partes. Y decía algo más que parece peyorativo: Es castellano mal hablado o inventado. No es así.!!
    Señores, el español y desde luego el catalán, valenciano y mallorquín son DIALECTOS nacidos del latín.
    Finalmente, efectivamente mis hijos de 40 y 38 años, de madre alemana, hablan perfectamente español, catalán -viven en Barcelona- inglés y mi hija estudia actualmente chino. Es una buena iniciativa con gran porvenir.
    Desde niños y de manera natural aprendieron español porque su madre y yo compaginabamos alemán y español constantemente.
    Además estudiaron en Madrid y Barcelona en el Colegio Alemán en el que era imprescindible estudiar español e inglés.
    Al parecer, ahora en Catalunya, no se estudia en español y es una asignatura más -muy mal aceptada por las autoridades autonómicas- y los jovenes que tengo la oportunidad de conocer, tienen un vocabulario pésimo tanto en catalán como en castellano/español. Y un conocimiento de la historia y cultura en general que da pavor. No se que será de ellos mañana. Pero mañana mismo.
    Por todo esto y por muchas más cosas que ahora no podemos tratar, radicalizarnos en el patriotismo nacionalista o idiomático, en cualquiera de ellos, es absolutamente retrógrado y carente de sentido futurista.
    Ha sido un placer y nos volveremos a encontrar en unas semanas
    Gracias por su buena acogida y salud y suerte para todos.

  45. Més que ràbia (potser també, no t’ho nego), llàstima. El títol intenta ser insultant, imagino. Però et desqualifiques tu mateix, amb l’estil. I sobre el contingut, res de nou. Hi ha molts acòlits del Losantos pel món.

  46. Puigmalet:

    Tinc una pregunta per a vostè -jajajajaja com si fossis el Carod-: Com es pot desqualificar un amb l’estil?

    Per favor, explica-me’l perquè segur que em vas a ensenyar molt amb la teva resposta.

    Sé que saps d’escriptura.

  47. Sé una mica d’escriptura, sé una mica del lloc on visc i sé que l’estil és tant la manera de presentar les idees com un punxó que s’usava per a escriure. Aquest darrer és l’estil que tu vols utilitzar, però per això calen idees més punyents i més originals que les de la COPE.
    Confio haver-te il·luminat convenientment.

  48. Pablo:

    Me encantan tus historias. Se tú bienvenido a mi casa.


    Bueno, era previsible.


    Exacto. La palabra clave es LIBERTAD de elección.

    Será interesante saber la opinión de tus padres.


    Un placer y buen viaje.

  49. Puigmalet:

    Creo que t’equivoques un poc, però només un poc.

    No vull ser punyent contra ningú. I el meu punxó no està dirigit als naZionalistes, com potser tu creus, sinó als espanyols que encara no s’han despertat i que ximplement us donen suport i no veuen la traïció – de la qual un dels assidus d’aquesta bitàcora, Minneconjou, parlava en el seu comentari-.

    Punyents heu estat vosaltres durant aquests trenta anys de traïció i de mitges veritats. Punxons són els quals amagadamente heu estat usant contra els vostres conciutadans no catalanoparlants.

    Et dono les gràcies. Punxó, punyent, traïció, són les paraules que als catalans naZionalistes us defineixen.

    Les meves idees no són les de la COPE, de debò que no. Però allò que diu Losantos, ho he estat pensant durant molt temps. De debò que eren els meus pensaments i els de molta gent, durant massa temps. Sento molt que no hàgiu pogut destruir-li ni amb diners, ni assassinant-li com un de l´Avui es lamentava fa poc temps.

    Te´n recordes? Ell deia: Llàstima que no li haguéssim donat el tir al cor. Ho va escriure a l´AVUI i la meravellosa, europea i súper civilitzada intel·ligència catalana muda, muda, muda. Cataluña, qui t’ha vist i qui et veu?

  50. Pues has tardado en darte cuenta, porque ya entoces Blas Piñar andaba haciendo este discurso ultranacionalista.

  51. M’has deixat un merda al bloc.

    Mira noi: Respecto la llibertat d’expressió i, conseqüentment, la d’opinió, encara que permetin que persones com tu vomitin bajenades pensant-se que postul.len.

    Només un prec, deixa d’embrutar el bloc amb la teva presència. Ves al submón on els quatre discapacitats psíquics com tu podeu explicar-vos bestieses.

    Sí no et suportes, sempre tens la solució d’arribar-te fins l’estació més propera, allitar-te i esperar que passi el tren.

    Ignoro si la medicina actual, tot i els avenços, pot trobar una solució i curar-te.

    Ho sento!

  52. Fas tot això per a augmentar exponencialment les visites al teu blog? Ets narcicista? Exhibicionista?
    T’he trobat a un blog entre comentaris de condol al blocaire J.M. Tibau: se li havia mort un parent… i plaf! trobo: el catalán es una puta mierda? i automàticament un altre comentari teu donant el condol. Tan ràpid vas escampant la teva propaganda per la xarxa que no et podies esperar ni un dia? No podies esperar encara que fos per respecte al dol?
    D’això se’n diu oportunisme i està totalment fora de lloc. Agitem les masses, fem que s’encabritin, apa, la pòlvora és a punt. Felicitats pq ho has fet molt bé!

    pd: No tens credibilitat… t t t t t t t T T T!

  53. Por respeto hacia el resto de comentaristas que no entendemos catalán,¿ podían hablar en Español?

    Referente a las personas que insultan al resto, con la tan manida palabrita de “fascista”, recomiendo el estupendo artículo de un catalán no nazionalista, gran escritor y estupendo músico: Sabino Méndez. donde retrata a la perfección a los verdaderos fascistas-leninistas. o camisas rojipardas nazi Onalistas, ya sean catalanes de ERC o batasunos, o peneuvistas del País Vasco o gallegos del BNG, y lo bien que se llevan con toda esta ralea antidemócrata el PSOE.


  54. Sería bueno que los catalanes escribieran en español para que los demás pudiéramos participar (bueno, si quieren que participemos).

  55. No mereixes una resposta digne, tot i així, faré l’esforc, no per tu, sinó per tots els que et llegeixen, que espero que no es deixin enredar per les teves paraules.

    Catalunya té una cultura i una llengua pròpies. Es tracta d’una cultura enriquidora (com totes), i ningú té dret a intentar erradicar-la. Els catalans, la immensa majoria, som persones respectuoses i pacífiques, i mentres n’hi hagi que sentim ben endins el nostre origen, que estimem d’on venim, la nostra cultura i la nostra llengua seguiran vives, per molt que gent com tu provi d’assassinar-les.

    Ara, si-us-plau, si tornes a deixar un comentari al meu blog, que sigui per deixar la teva opinió respectuosament sobre el que he escrit, com fa tothom, no per fer propaganda de la teva web, que per cert, pel que he llegit per sobre, no m’interesa gens. Ho sento, amb propaganda no n’hi ha prou, el contingut ha de tenir un cert nivell.

    En castellano para los que no entendáis el catalán:

    No mereces una respuesta digna, pero voy a hacer un esfuerzo, no por ti, sinó por todos los que te leen, que espero que no se dejen engañar por tus palabras.

    Cataluña tiene una cultura y una lengua propias. Se trata de una cultura enriquecedora (como todas), y nadie tiene derecho a intentar erradicarla. Los catalanes, la inmensa mayoría, somo personas respetuosas y pacíficas, y mientas siga habiendo gente como yo, que sentimos nuestro origen, y amamos el lugar de donde venimos, nuestra cultura y nuestra lengua seguirán vivas, por mucho que gente como tú intente asesinarlas.

    Por favor, si vuelves a dejar un comentario en mi blog, que sea para dejar tu opinión respetuosamente sobre lo que he escrito, como hacen todos, no para hacer propaganda de tu web, que por cierto, por lo que he leído por encima, para nada me interesa. Lo siento, con propaganda no es suficiente, el contenido tiene que tener un cierto nivel.

  56. Interesante post, me gustan este tipo de posts donde se trata el trasfondo de la realidad social de épocas cercanas. De paso aprovecho para saludarte, que hacía tiempo que no comentaba nada.

    PS. No sé que he hecho que antes se publicó el post en una entrada que no correspondía.

  57. El problema no són les llengües sinó el que es diu en eixes llengües i també com es diu. Tu parles en castellà i dius bajanades i, a més, tens un estil mediocre. Per tant, el teu castellà és una merda.

  58. Vayaaaaa. Qué montón de comentarios. ¿Te sientes más querido así? ¿Más realizado? … Después de haber ido por ahí dejando mensajitos en otros blogs para que la gente venga hacia aquí … Tío eres como un spam toca cojones jejeje.

    La verdad, qué risa tu post. Sobretodo después de unas elecciones en las que los catalanes hemos decidido el gobierno de España … ¿Es eso lo que te molesta?. Me da la risa cuando pienso en los del PP haciendo la pelota a los catalanes … Espe diciendo que va a hacer un colegio en catalán en Madrid… jajajaja. Todo por un puñado de votos, igual que hizo Aznar cuando hablaba catalán en la intimidad!. Pero si a los catalanes se nos da por culo o se nos lame el mismo dependiendo del interés político de turno, hombre. Señores y señoras, que en Cataluña no hay problemas con el castellano! Que os han vendido la moto!

    Bueno continuad con vuestras pataletas que yo continuaré descojonándome.

    Ah, si lo que quieres son visitas en tu blog, puedes dejar el siguiente mensaje en los blogs de los demás:

    “Es triste de pedí, pero más triste es de robá. Tengo baja la autoestima. Por favor entra en mi blog y dime algo”

  59. sinblancaporelmundo:
    (Te copio el mensaje de mi blog. Perdón por alargarme tanto, quise explicarlo al detalle.)

    Respondo a tu pregunta: Cuando me he encontrado en la situación de que se usa el catalán a sabiendas que su receptor no lo entiende, mi reacción ha sido hacer de traductor. Concretamente, explicaré un caso claro que me sucedió este mes de Enero. Dejo a su raciocinio si este es un caso aislado o es una idea más ampliamente compartida entre defensores del catalán.

    …Estabamos hablando (en castellano) un joven catalán, una chica murciana y yo (no diré sus nombres por si ellos no quieren). En un momento dado y sin darnos cuenta, los dos chicos dijimos algunos comentarios entre nosotros en catalán, y la chica nos pidió que cambiaramos de idioma aún cuando solo hablaramos entre nosotros porque ella no nos entendía y se sentía apartada. Creo que tenía razón, le expliqué lo que habíamos comentado y cambiamos de idioma.

    Pero entonces el joven, que dice ser independentista, le contestó una pregunta en catalán dirigiéndose a ella misma. Como el ambiente era festivo y para evitar confrontaciones, me limité a traducírselo y le resté importancia, pero el joven empezó a criticar a la chica diciéndole que él y yo “teníamos todo el derecho a hablar en catalán entre nosotros aunque hubiera más gente alrededor que no lo conociera, porque nosotros vivíamos en Cataluña y ese era el idioma de su país”. Le dijo que “si España es un país y Cataluña forma parte de él, entonces porque debía ser él el que cambiara de idioma y no ella”, y que si quería hablar con él lo hiciera en catalán. Argumentaba que si la chica no sabía catalán (“algo que en cierto modo debería)”, que almenos no impidiera que lo hicieran otros, y que “habiendo diferentes idiomas en Cataluña, cada uno debía dejar hablar a los demás como quisieran”.

    Encontré esas justificaciones en cierto modo legítimas (esté o no a su favor) pero de bien seguro nada prácticas, porque simplemente estábamos hablando y forzar el catalán era absurdo porque la chica no sabía, lo que sólo conllevaba discusiones.

    Luego animé al joven a hablar en castellano para que la chica lo entendiera, puesto que horas antes habíamos estado (o intentado) hablar inglés con un italiano y el caso del cambio de idioma al castellano no era un caso muy distinto. Le animé también diciéndole que mantuviéramos la política aparte y así mantendríamos el buen ambiente que había habido entre nosotros tres hasta entonces.

    Entonces el joven se contradijo, pues dijo que si quería la chica, él no tenía ningún problema en hablarle en castellano. Es una contradicción porque, además de decirlo en catalán, sí que estaba poniéndole trabas a la conversación, pues en el tramo final yo tuve que traducir sus palabras a la chica. Además, el joven dijo “que igual que él hablaba castellano cuando viajaba fuera de España, ella debía hablar catalán cuando estaban en Cataluña”; lo curioso es que esta conversación tuvo lugar fuera de España.

    El joven buscó mi apoyo para defender al catalán y a Cataluña en general, pero se lo negué porque pensé que simplemente debíamos adecuarnos a la situación. La chica también buscó mi apoyo (y el de más gente que se unió al ver la exaltación de ambos), aunque simplemente me limité a traducir. El resto de personas se mantuvo muda o habló de otras cosas. A partir de ahí ambos se perdieron el respeto, la chica se enfadó seriamente y dijo que aquello era una falta de respeto hacia su persona y se fue a dormir (era de noche) “para evitar problemas mayores”.

    Yo intenté en todo momento evitar confrontaciones, intentar dejar esos problemas de banda y pasarlo bien. No se si consideran correcta mi actuación (podría haberme posicionado más y haber apoyado a uno u otro), que por cierto fue tan espontánea como inesperada, pero lo que creo seguro es que la actitud del joven no la fue.

    Creo que el último comentario de kabish resume mi posición. Me quedo también con una frase del comentario de Minneconjou: “no es violando derechos como se defienden derechos”, y me remito a mi anterior post para la explicación sobre todo lo dicho. Interesante artículo, y más interesante aún con los comentarios :). Un saludo cordial

  60. Comentario injurioso trasladado al Cubo de la basura.

  61. Popota, Victorià, Josep:

    Me parece bien tu opinión, pero no la puedo tomar en serio si me das una dirección de CE falsa.


    Bienvenido a mi casa.

    Mi salud bien, gracias. Cuando tenga algún problema me pondré en contacto contigo.


    Bienvenida a mi casa.

    ¿Qué tiene que ver el meter la pata y luego pedir disculpas o un discurso con o sin credibilidad?

    Fanfatal, Kabish:

    Vale. Que los dos estéis de acuerdo en algo, no deja de ser gracioso.

    El vínculo de Méndez muy bueno, FF.


    Bienvenido a mi casa.

    Nadie intenta hoy en día ni erradicar, ni, como dice usted, asesinar ¿? una cultura. Me entra la risa si usted se refiere al catalán hoy en día, cuando ustedes multan a los que libremente usan en su país la lengua que les da la gana o condenan al fracaso escolar al escolarizar en otra lengua que no sea la materna.

    En cuanto a que el catalán seguirá vivo mientras haya gente que ame sus orígenes y tal, estoy de acuerdo. Pero mucho me temo que las medidas de imposición y coerción que han implantado ustedes no son sino el canto del cisne de una cultura moribunda e inoperante. La gente de la calle, por mucho que esté escolarizada en catalán, sigue usando el castellano, siento mucho decirle.

    Miguel Ángel:

    Siempre un placer verte por aquí.

    Pol Smith:

    Muy interesante tu historia. Necesito un poco de tiempo para responderte como mereces.

    • Si te vas a vivir a Italia, aprenderás italiano sea tu lengua materna o no. Pues en Catalunya igual. Todos tenemos el mismo derecho a saber las dos lenguas.
      Los que se niegan a ello son los que proyectan la desaparición del catalán y, no es casualidad, que sean los mismos que siempre la persiguieron.
      Aprender más lenguas mejora el conocimiento no lo empeora y si una de las dos lenguas debe desaparecer de Catalunya que sea la extranjera: el castellano (mal llamada española). Que se vaya de una puta vez por donde vino.

  62. Hola buenos días
    Pues pienso que no, ya veo que usted si…todo es respetable, en eso se basa el entendimiento de las personas, creo…
    Y usted, piensa que el castellano es una puta mierda?

    Gracias de todas formas, por visitar un bloc de mierda, en catalán.

  63. Acabo de llegir un escrit teu en un bloc amic i m’ha sorprès que encara avui hi hagi gent que amb aparença progressista, cerqui arguments, arguments per auto-afirmar-se.

    Que vols dir que el català és una merda, la llengua, o et refereixes a les persones?

    Llegint detingudament el seu article veig que :
    Anomenes “transición”, quan no hi ha hagut res que s’hi assembli. De quina transició parles?
    Quan els del règim anterior van continuar mantenint la seva influència en el poder.
    Veig que el dictador el va ben “instruir”, et va deixar petjada en la teva ment.

    Dius que et penedeixes ?
    Només senten penediment els qui se senten culpables d’alguna cosa.
    No et sembla potser que avui t’hagis deixat, t’hagis adormit, emborratxat de ideologia que et fan sentir més còmode i t’hagis posat a la fila de la militància, creure i que decideixin per tu… i has deixat de ser tu mateix?

    Parles de democràcia.
    Quina democràcia ? La que permet tancar mitjans?
    La de l’estat de setge permanent que la té segrestada?

    Em sembla que només cerques protagonisme amb les teves provocacions, per això no faig més extensiva la meva opinió…

    reflexiona, reflexiona!
    Desperta’t i surt de la fumera…

    home és que un ja té una edat perquè a aquesta alçada li vulguin aixecar la camisa

    m’has donat una idea i publicaré el teu escrit al meu bloc a VilaWeb i el que jo penso…


  64. Canta razón tiene a mi me visitó un catalan que es un jijolo y ahora me pide dinero y le quiere dar tusa a mi sobrina carnal que es una lagarta. Todos los catalanes son unos chanchos porque otro que se tenía que casar con mi hermana lo metieron en la cárcel por hacer fotos a los niños orinando en el parque que por poco lo matan los padres cuando lo vieron

  65. Luluji:

    Benvinguda a casa meva:

    Em temo que vostè, si bé ha visitat la meva bitàcora, em temo, que no ha llegit l’entrada en la qual li feia a vostè una pregunta.

    Vostè creu que jo penso que sí, però ara li he d’aclarir que penso que no, ja que vostè no ha llegit l’entrada.

    Em pregunto per quina rao els catalans en general, i els naZionalistas en particular, es posen nerviosos quan se’ls nomena la llengua catalana o la dictadura naZionalista a Cataluña. Jo penso que en el fons senten vergonya pel sojutjament d’almenys el 50% de la població per part de l’altra part.

    Amb els millors desitjos per al futur, m’acomiado i li dic que la seva bitàcora m’encanta perquè està plena de flors com vostè.

    (Dejado en su bitácora contestando a su amable visita)


    Bienvenida a mi casa: Me temo que usted, si bien ha visitado mi bitácora, me temo, que no ha leído la entrada en la que le hacía a usted una pregunta. Usted cree que yo pienso que sí, pero ahora le tengo que aclarar que pienso que no, puesto que usted no ha leído la entrada. Me pregunto por qué razón los catalanes en general, y los naZionalistas en particular, se ponen nerviosos cuando se les nombra la lengua catalana o la dictadura naZionalista en Cataluña. Yo pienso que en el fondo sienten vergüenza por el sojuzgamiento de al menos el 50% de la población por parte de la otra parte.
    Con los mejores deseos para el futuro, me despido y le digo que su bitácora me encanta porque está llena de flores como usted.


    Bienvenido a mi casa.

    Me alegro de que te preocupes por mi salud. También es un honor que hayas decidido poner mi escrito en tu bitácora, pero haz el favor de poner la procedencia, no se vayan a creer que te has pasado al otro bando.

    Gladys Pinilla

    Bienvenida a mi casa.

    ¡Qué vida más perra, señora! Hay que sufrir y sufrir con los machos. Es que son nuestra perdisssión.

  66. Ich verstehe nicht Katalanische.

  67. Jajajajajjajajaja


    Das ist sehr schade, mein Freund !

    Sie wissen, Sie sind ein spanischer Progre, hierfür müssen Sie katalanisch lernen, weil Katalanisch die Sprache der Zukunft ist, die wahre, neue Sprache des Imperiums

  68. Sinblanca…¿¿cuántos idiomas sabes?? Me has dejado loca…

    Bueno, que nunca te he dejado un comentario, pero ahora quería decir algo sobre el tema.

    Respeto y educación.

  69. Le recomiendo encarecidamente un libro que seguro será de su interés:
    Por lo leído coincide enteramente con sus gustos.

  70. Isi:

    Bienvenida a mi casa, ¡al fin!

    Totalmente de acuerdo contigo.

    Hermano Joaquín:

    Bienvenido a mi casa.

    Buena recomendación. La verdad es que sería una lectura muy recomendable para gran parte de la población española que parece estar abducida por z y los naZionalistas.

  71. Hola
    Si que le he contestado, si se mira atentamente mi comentario vera que lo inicio con una negación, es lo que pienso…i en absoluto me pongo nerviosa, la cuestión que propone, me es indiferente…
    Gracias por el piropo, jo soy una flor, pero usted es un capullin provocador 🙂
    Y cerrando el tema, evidentemente para mi no es una puta mierda, ya que si no, mi bloc, no seria en catalán, no cree?
    Buenos días.

  72. Efectivamente nada, la nota respecto a tu credibilidad estaba (está) en la post data. No me gustan los comentarios excesivamente largos.
    Tu credibilidad está por los suelos cuando utilizas un lenguaje peyorativo, destructor y provocador -de forma gratuita; cuando te recreas en sentimientos anti-todo, cual sedimentos cancerígenos de nuestra historia. Con un discurso constructivo, además de ganar credibilidad, muchos de nosotros entraríamos en un diálogo contigo.
    Respecto al pésame, efectivamente, se lo diste al interesado, pero ¿no podías haber invertido unos segundos más y borrar la entrada anterior: “el català és una puta merda” y colgarla pasados unos días? No sé…, sólo por respeto al dolor.

  73. Genial. Te pido permiso para citarte en mi blog.

    Un saludo

  74. Comentario injurioso trasladado al Cubo de la basura.

  75. Me ha costado mucho leer tu post, pero no porque sea una analfabeta funcional, sino porque aburres a las ovejas.

    Y dices muchas tonterías, qué quieres que te diga. Soy madrileña, nacida en Carabanchel y he vivido en varios lugares de España entre ellos, en Barcelona, nada menos que 28 años, allí nacieron mis mellizos.

    No temas, no te voy a contar mi vida. Durante esos 28 años nadie, nunca, jamás, me despreció o dijo algo en contra de mí por ser madrileña y hablar el catalán con un acento horroroso. Mis hijos son perfectamente bilingües y hablan un castellano perfecto y escriben un castellano mucho mejor que el que tú utilizas.

    He vuelto a mi tierra y a veces me he sentido insultada por gente como tú por parecer catalana. Adoro a los catalanes y sobre todo adoro Barcelona, donde he encontrado a la gente más tolerante de toda España.

    Que a estas alturas, venga a decirnos que la Nova canço era una conspiración catalono-nacionalista es para llorar de risa. Sólo eso ya te descalifica.

    Creo que deberías viajar más y culturizarte un poco.

  76. Sí. A ti te voy a dejar mi mi dirección CE, jajaja, ¿para que me lo llenes de porquería como esta? No gracias.

    Los nacionalismos hoy en día se retroalimentan. El nacionalismo españolista del PP, COPE etc genera una respuesta inversamente proporcional … de ahí que ERC tuviese 8 diputados en el congreso (ganados tras la mayoría absoluta del PP). Hoy, ERC tiene 3. Eso gracias a Zapatero. Así que a quien no le gusten los nacionalistas que de las gracias al presidente español y al PSOE, por que ellos han conseguido el descalabro de las fuerzas nacionalistas. Así que mira, incluso los del PP tienen algo que agradecer a Z … jejeje … continuad pataleando.

  77. Luluji, Sigorgik:

    Os acepto las críticas. Sólo una preguntita pequeñita y fácil de responder: ¿Soy un fascista y un crispador si quiero educación bilingüe (50-50) para mis hijos?

    En cuanto a lo del título de la entrada. Por favor, utilizo la técnica de Benetton para chocar. A la gente inteligente le resbalan las palabras, lo que importan son los hechos, como, por ejemplo, impedir que un profesor de universidad dé su clase. ¿Por qué no os escandalizáis por eso y lo comentáis en vuestras bits?


    Bienvenido a mi casa.

    Adelante, si pones la fuente, copia y pega lo que quieras. Pero escribe la dirección URL completa de tu página electrónica. Si no, la gente no puede accederte a través de tu vínculo aquí.


    Bienvenida a mi casa.

    Me alegro de que a ti y a tus retoños os haya ido tan bien en Barcelona. Es normal. Si eres una castellanohablante tipo Montilla que se amolda y que ha internalizado el victimismo de los catalanistas, no me extraña que te adoren. Otra cosa hubiese pasado si hubieses dicho NO a la inmersión lingüística o hubieses exigido que izaran la bandera española en los lugares públicos, etc, etc, etc.

    Buenafuente, se llama Buenafuente y no Bonafont, y es un separatista que se avergüenza de sus orígenes.

    Por cierto, tu bitácora me encanta. Pones unas fotos divinas -¿eres fotógrafa? Escribes de tal manera, que me enganché desde que leí la primera entrada. Enhorabuena.


    Home, noi, no me digas eso. Que yo soy un peasssso pan.

    El PSOE ha recibido el voto útil de los separitistas vascos y catalanes porque saben que z está vendido a ETA y a sus correligionarios del PSC. Cuando los españoles de a pie se den cuenta de que z quiere destruir España, adiós PSOE para siempre. Lo malo es que z tiene todas las TVs, pero tiempo al tiempo.

    • Montilla no se integró nunca como esta señora. Una vez elegido presidente de la Generalitat empezó a aprender catalán en 4 días porque jamás se había integrado en Catalunya. Lo raro es que pudiera trabajar sin tener el nivel C de catalán en la administración y llegar a presidente.
      Tu, como eres del PP no soportas a nadie q

      • que impida a los fachas del PP subir al poder para robar dinero a los trabajadores que es lo que siempre han hecho.
        Ni Buenafuente ni nadie se avergüenza de sus orígenes. Los únicos que deberían avergonzarse de sus orígenes son los del PP y así lo hicieron, a regañadientes, cuando se vieron obligados por la presión popular a condenar el franquismo (aliados de nazis y fascistas italianos).
        Estos son los que deberían se destruidos para siempre y contra estos nos uniremos todos siempre, seamos independientes o no, con los castellanos y con quien sea.

      • Hay que destruir esa españa del PP. No la de la buena gente trabajadora sino la de los parasitos del PP que viven del trabajo de los demás. Los racistas del PP que sacan videojuegos disparando a emigrantes o el alcaldable de Badalona que criminaliza la emigración con la finalidad de crear ambiente para proceder a su expusión. Los intolerantes dictadores que no quieren dejar hablar a la gente de la calle en su propia lengua. a estos fascistas, nazis de mierda hay que destruir ya sea en Catalunya, en España y en el mundo entero.

        Corre, a censurar este post ahora para que nadie pueda leer la verdad, venga.

  78. ¡La que has liado! Como medalla de plata (fui el segundo y me temo, uno de los más sensatos) he observado los toros desde la barrera. A este guirigai no le veo solución posible. Cuando una lengua, una herramienta de comunicación, se convierte en una “identidad” (mi patria es la lengua, dijo Fernando Pessoa) y a su vez, en un muro, pierde su razón de ser.
    Según los pancatalanistas, el catalán es el idioma que se habla en Cataluña, obviamente, en el “Pais Valenciá”, en Baleares, en el Rosellón, en l’Alguer. Pues bien, estando en Ibiza quise hacer la gracia de practicar el catalán. Yo hablo valenciano y la taquillera de la estación de autobuses, ibizenco. Yo le pregunté y me entendió a medias. Ella me contestó con toda amabilidad pero yo no entendí un pijo. Resultado: cambiamos al castellano y todo fue bien claro. Me enteré de todo y pude llegar a San Antonio. Un alivio, oyes.
    Yo creo que el empeño en convertir un dialecto barcelonés en un estandar (metalengua) marca el comienzo de una esquizofrenia que parece no tener fin. Cuando vas a Barcelona e intentas hablar en valenciano, automáticamente cambian al castellano porque ese acento no les parece serio, porque está contaminada.
    Te han llovido hostias por todos lados, escupitazos a granel, exorcismos sin nombre. Enhorabuena gladiador. Los que van a platicar, te saludan.
    Un saludo, güey.

    • Menuda estúpidez. Eso es como si te vas a Chile y hablan rápido en su jerga,no les entiendes y te pones a hablar en inglés con ellos.
      Es la misma anécdota que has contado pero con otros idiomas.
      Por cierto València fue repoblada con gente de Lleida y Aragón y por tanto nuestro acento es más parecido que con el Barcelonés puesto que no debes saberlo.
      Los catalanes no somos pancatalanistas como dice el neonazi de la COPE Losantos al que tanto te gusta repetir como un loro. Somos catalanes y punto y los españoles nos dividieron y nos prohibieron mantener contacto. Esto todavía lo hacen los fascistas del PP como Camps cerrando las antenas de repetición de la TV3 pagadas por los propios vecinos catalanes de Valencia (los valencianos que sí saben en qué país viven).

      No vengas con tantas mentiras porque los únicos imperialistas de Valencia sois los españoles y no nosotros, ¿como vamos a ser imperialistas de nuestro propio país? ¿Acaso Madrid es imperialista de Cáceres? Pues Valencia y catalunya igual.

      Valencia era catalana en el siglo XIII, Granada no fue castellana hasta fines del siglo XV (1492) ¿qué hablas tu de pancatalanismo o imperialismo catalán?,.. si el único imperialista eres tú.

  79. Bueno, la tal Tesa es una sectaria de tomo y lomo, y lo de decirte que tienes que viajar más(sic) y culturizarte un poco…. es para mear y no echar gota.

    Tesa, cari, me parece que la que tiene que viajar más, porque tus viajes me parece que se limitan a Barcelona-carabanchel.
    eres tú, además de abrir la mente, a parte de otra parte de tu anatomía que me parece que lo usas más bien poco, y asi te pasa.

    Tu blog y la demagogia que destilas, sí que me parece un rollo y de alguien que sólo ve lo que le interesa ver.

    Los demás también conocemos Barcelona y la intolerancia de los nazis socialistas que tanto te gustan.

    Por ejemplo en Barcelona se cierran bares como el Eagle, porque se practica sexo en su interior. Vaya con los sociatas del ayto!!!!


    Y se acosa a los transexuales por parte del ayto socialista de Barcelona:


    Tesa Tesa, hay que viajar más e informarse de las cosas, antes de acusar a los demás de lo que no se sabe.

    Aclaración de Sinblancaporelmundo: a parte de otra parte de tu anatomía que me parece que lo usas más bien poco, Este tipo de afirmaciones en mi bitácora no las quiero. La dejo para que no se vuelvan a repetir, pero ni yo digo esto, ni creo que Fanfatal esté hablando en serio. En el futuro pondré comentarios así en el Cubo de la basura que es donde pertenecen.

    Fanfatal: Tu discurso es coherente. A tu discurso no le añade nada un comentario tan soez. Estoy de acuerdo contigo un 95% de las veces, pero con eso no.

    • Fanfatal en tu blog falta una foto e Rohm porque era tan homosexual y tan nazi como tú. Y si Losantos pudiera te mataría por tú condición de homosexual como lo haría Franco y todos los cerdos cuyas ideas defiendes a pesar de ser homosexual. ¿O no son ellos los defensores de la família cristiana y los que niegan el derecho de igualdasd a los homosexuales y los que niegan el matrimonio entre homopseuales o que los homosexuales puedan adoptar hijos? ¿no son elos a los que lames el culo? Si tú eres tonto, nosostros no tenemos la culpa.

  80. Rubén:

    Es que a nadie se le esconde que el valenciano y el catalán -para una persona culta en ambos idiomas, como pasa entre el galego y el português son intercomprensibles (ni idea si existe el palabro en español), y los valencianos no lo niegan.

    Pero otra cosa bien distinta es decir que ellos deben de adoptar el dialecto de Barcelona como lengua estándar del valenciano literario.

    Pero otra cosa es querer formar parte de esa entelequia llamada països catalans, y renegar de ser valencianos con identidad propia.

    • ¿Pero qué dices tú? ¿tú estás loco? ¿no pensáis decir nunca ni unasola verdad los fachas del PP? ¿ni por una vez en la vida?
      ¿donde está escrito que se quiere obligar a nadie a adoptar el dialecto oriental (Que es el de Barcelona y Girona)? ¡Si no tienes ni puta idea de filología! ¿dónde vas? ¡no sabes ni de lo que hablas! ¡como todos los fachas del PP! Que os inventáis las cosas y ¡hala! si cuela, cuela (como siempre ¿no?).

      Si ni siquiera a los del dialecto norte-occidental nos obliga nadie a hablar como los de Barna. ¿qué coño dices? ¿ves como no sabes nada?

      ¿qué hablas tú de lo que no sabes nada? ignorante mal intencionado, manipulador, imperialista,… como tods los del PP.

      Los únicos que no quieren ser valencianos son los españoles porque Valencia, cuando era libre esaba Confederada con la corona de aragón en igualdad de condiciones y si ahora recuperó la Generalitat Valenciana fue por imitación de la Generalitat Catalana. Qué casualidad, tenemos las mismas instituciones y la misma lengua a ver si seremos el mismo país y el único imperialista es el españolito.

  81. Más soez es llamarte analfabeto, que eres un rollo que aburres a las ovejas, que te culturices, que viajes más, que eres un pedante y demás.

    La parte de la anatomía a la que me refería y que ejercitaba poco, y por eso estaba cerrado, era el cerebro. ¿O qué es lo que tu mente calenturienta estaba pensando?

    Pero si te gusta que esta mujer te diga esas cosas allá tú.

    En fin que hay que abrir más la mente como cantan las nancys Rubias y Merche:

  82. Fanfatal:


    Entonces ha sido mi mente calenturienta, pervertida y mal pensante.

    Mis disculpas.

    Las otras cosas que me llaman no son más que parole, parole, parole.

  83. En qué estabas pensando en el “pussy” de la señora? hombre!!! la parte de su anatomía que usa bien poco a mi parecer es el cerebro o lo que lleva encima de los hombros, porque no se puede escribir un comentario más descalificativo y encima decirle a alguien que vive fuera de España, que viaje más y se culturice(¿?)

    El Post que he leído en su blog,sobre el votar a la izquierda, me parece de lo más cursi y pedante que he leído en mucho tiempo, ni Z le supera en cursilería. Y está visto que sus vecinas carabancheleras le han hecho poco caso.

    Y parece tener un “corazón de Hielo” respecto a la problemática de los castellano-hablantes en cataluña:

  84. Fanfatal eres penoso. Mi cerebro está muy bien alimentado y de lo demás tampoco me puedo quejar. Por tus rencores y la rabia que estilas no parece ser tu caso.

    Y doy por finalizado mi intervención. Nunca discuto con personas que carecen de argumentos. Me aburren.

    Y para cursi tu “corazón de hielo” Mi hijo lo tiene como el título de un canción compuesta en su adolescencia.

    “Simblanca” reconozco que tienes un poco más de estilo que muchos de tus contertulios, pero no voy a venir más a este blog donde se fomenta la estupidez y el odio sin sentido. Es patético.

    Podeis ver mi cara en mi blog, sí las fotos son mías, las ideas también, no me escondo como otros, y soy de las que voto a izquierda unida, uy, que roja que soy.

  85. Hija, te aburre todo, tus descalificaciones ya sabes por donde me los paso, sweetie.

    No sé donde está la rabia, sólo he replicado tus despropósitos, decir a gente que vive fuera de España y que viaja continuamente, que viaje y se culturice, pues sólo te califica y te descalifica a ti.

    Me parece muy bien que votes a Izquierda Hundida, ese partido o coalición que apoya dictaduras tan brutales como la castrista o la china que masacra tibetanos.

    Necesitan tu voto como oro en paño, ya que están al borde de la desaparición sobre todo en Madrid.

    Y chica, no te aburras tanto, que hay cosas muy divertidas que hacer.

    Si no te gusta las Nancys rubias, lo siento pero son muy divertidas y te pueden sacar de tu aburrimiento perpétuo.

    Y no te preocupes que viajamos mucho, también a Barcelona, y conocemos mundo.

    See you tolerante.

  86. Hola tio, ¿qué tal? El artículo está guay, pero no deja de preguntarse mi cerebro algo que me parece ciertamente hipócrita.

    Resulta que, como la mayoría de los que suelen hablar sobre “el problema catalán”, son españoles, el debate se cercena de tal manera que sólo se escucha un discurso monotemático y pro-español, sin tener en cuenta el otro lado.

    Resulta que, como la mayoría de los que suelen criticar a Cataluña y su naZionalismo han bebido de las fuentes del imperialismo español, clasifican a los de ERC o CiU como NAZIonalistas, sin ver la viga en el ojo propio. Es un oprobio, un afrenta, a los que no pensamos con doble moral. Resulta ahora que hay naZionalismos buenos o malos, por el hecho de tener o no “500 años de camino común”. Resulta que uno sí que puede imponer su lengua oficial, porque defienden su cultura, pero si lo hacen otros con OTRA de las lenguas oficiales son “temerarios autoritarios” (y dejo ahora de lado a esos temerarios autoritarios, que sí que existen, pero que no creo que sean la regla en las regiones denominadas Nacionalistas).

    Yo, como ya te dije en comentarios anteriores, desprecio el nacionalismo, el minimizar la persona y convertirla en siervo de una bandera, rechazando su propia luminosidad para ir apagándose en batallas patrióticas que ni le benefician ni le perjudican, pues no pertenece al ciudadano, actualmente, decidir en la política.

    Estoy de acuerdo en que no debe dejarse que unos energúmenos multen o insulten a un pibe por poner un cartel en castellano. Pero basta ya también de querer parecer indiginados los mismos que luego ponen a parir a los catalanes y vascos. Basta ya del “españolito medio” que quiere tener “su” territorio unido pero que considera “polacos” a los que no hablan español. Esa hipocresía me mata. No me refiero a tí, porque veo que tu tienes tus razones lógicas para temer u odiar a esos nacionalistas. Me refiero a la inmensa e ignorante mayoría de la población española, tan bañada en colores rojigualdos que no atienden a lógica alguna, y repiten como loros lo que el político interesado repite con maldad.

    Hemos de tener en cuenta una cosa: si existe el problema de los nacionalismo periféricos, no creo que sea por otra razón que vaya más allá de la existencia de otro nacionalismo, más grande, más mediático, pero menos presente en el ideario de la gente: el nacionalismo español.

    Solución a los naZionalismos pequeños, matar al gran naZionalismo. Si uno no ataca, los otros no tendrán por qué defenderse, y viceversa. Y podremos vivir un poquito más libres, sin tener por qué buscar enemigos en todos los recobecos del país.

  87. Boigandreau:

    Si tú me dices que hay naZionalismo español, dime tú que partido político, qué corriente ideológica articulada existe hoy en España que quiera volver al centralismo o que quiera prohibir la enseñanza de las lenguas vernáculas como sucede por ejemplo, en Francia.

    Dime tú dónde está el nacionalismo español tan horroroso que ha dejado que la idea de España desaparezca de los libros de texto. Dime tú dónde está el naZionalismo español que ande matando nacionalistas catalanes o vascos o ande extorsionando empresarios nacionalistas. Dime tú dónde está el nacionalismo español que prime a los de una región sobre otra como sucede en Cat o Vas.

    El naZionalismo español es absolutamente inexistente, porque si existiera se habría acabado con el terrorismo subrepticiamente, o a la británica, a la alemana , o a la israelí. No, no existe naZionalismo español, en absoluto.

    Lo que existe es, como dice Matritensis en uno de los primeros comentarios en otra entrada, patriotismo. Este patriotismo emana de las inquietudes de gentes de muy diversa ideología que ven cómo España se va literalmente al carajo.

  88. Ese patriotismo es demagogia pura igual que “Dime tú dónde está el naZionalismo español que ande matando nacionalistas catalanes o vascos o ande extorsionando empresarios nacionalistas”. Pues lo hubo, y joder que si lo hubo!!!En los setenta, en los ochenta y casi hasta los noventa. Pero claro, eso no salía en los medios españoles…¿qué más da que se carguen a un abertzale??Son basura…¿no? Y eso quizá tú no lo tengas en tu metne, pero estáte seguro que la gente que anda ahora con sus pistolitas pintadas con los colores de la ikurriña sí que se acuerdan de esos comandos antinacionalistas. La manera alemana, o la francesa, como tú mencionas, es juego sucio, y si permites el juego sucio luego no te quejes de que te tiroteen…es como le digo a mi amigo cuando dice:”A esos vascos si que les daría yo balazos”, le respondo: “Pues amigo, acabas de legalizar éticamente su forma de hacer las cosas” ,

    Un patriotismo español lleno de mitos y falsas premisas. Nacionalismos de todos los niveles son basura. Pero tu justificas el que más cerca está de tu manera de pensar. Quizá, si hubieras nacido en alguna de esas dos regiones darías LAS MISMAS razones, pero contra otro objetivo. España no se va al carajo, y ni los nazionalistas de un pequeño lago, ni los naZionalistas del gran lago, van a conseguirlo. El miedo para las ovejas, las personas podemos pensar. Dime tú en qué escuela de Madrid se enseña catalán, o vasco, o gallego, o asturiano…Si fué noticia que Esperanza Aguirre (esa lider….) iba a abrir una escuela de catalán en la capital!!El mismo odio que se fomenta hacia los castellanos en esas regiones, se fomenta en las Castillas para con los ciudadanos de esas regiones. Y yo no estoy de acuerdo con ninguna de las dos formas de llevar las cosas. Pero esto no es una guerra de un solo bando. Hay dos bandos, solo que uno no se tiene presente por obvio.

    En fin, que no veo tu razonamiento por ningún lado. Estamos hablando de un país que tiene “democracia”(si se puede llamar así al sistema que aquí impera), muy fuertemente ideologizado con posturas muy pro-españolas, pues salimos de una dictadura que sí se encargó de cargarse a la gente y prohibir el idioma de otros..Y eso fué hace treinta añós. Si la Transición hubiera sido verdadera, si los criminales no siguieran aún en sus asientos de “alianza popular”, si no existiera ese franquismo sociológico en gran parte de la población, ni ese naZionalismo execrable en las periferia, no tendríamos ni ETA, ni Terra Lliure, ni mierdas patrioticas de ninguna puta nación.

    Como decía anteriormente alguien en un comentario: El problema de España es que está llena de españoles 😀

  89. Boigandreau:

    ¡Qué curioso! Eso lo dijo, Matritensis, el que también dijo que en España no había naZionalismo sino patriotismo.

    Pero yo no creo que el problema de España sea que esté llena de españoles. Creo que el problema de España es que está llena de gente que tiene pasaporte español y que no sabe cuál es su país..

  90. Leyendo a BOIGANDREAU y cuando habla de esos comandos antinacionalistas me viene a la cabeza cuando en la epoca de Galindez, los sabados por la noche bajaban las lecheras al casco viejo y cojian a todos los que tuvieran pinta de punky, heavy, abertzale, antisocial….malas pintas en general y cuando estaban llenas, todos para arriba, para intxaurrondo y toallazo tras toallazo, manguera fria a presión toda la noche del sabado. te podia tocar o no pero esa la diversión a la que te arriesgabas si te pillaban,si te tocaba a ti ese sabado, y no veas como hubiese un atentado ese mismo dia, y hablo con conocimiento de causa, no por alguien que lo sufrió sino por uno de los encargados de manejar la manguera, que por cierto, a pesar de haber sido picoleto tampoco estaba de acuerdo con esos metodos, que no hacián mas que incrementar el odio a los españoles. pero bueno, eso como no sale en la prensa, vamos a hacer como que nunca ha pasado, y vamos a seguir pensando que los malos son SOLO los vascos que no quieren ser españoles.

  91. Putoloco:

    Lo que tú me cuentas es hipotético, ¿quién sabe si sucedió o no? Las agresiones a Gotzone Mora, a San Gil, a Díez etc son verdaderas y de hoy mismo.

    Se va a estrenar “El infierno vasco”. ¿La vas a ir a ver?

    • Si, propaganda de nazis peperos,… la voy a ver para reírme de lo capullos que son los fachas.

      • Todos los nazis peperos de mierda en el vasco obligándoles a hablar en castellano (y llamándolo español), robando su dinero y encima quejándose porque se rebotan,… menudos gilipollas los nazios del PP y los cerdos resentidos como tú.

  92. lo que yo te cuento no es hipotetico, ¿quien sabe si sucedió o no ? uno de los que agarraban la manguera y daban palizas a los chavales, y se que es tan cierto como que estoy escribiendo esto ahora mismo, tu tambien lo sabes, pero prefieres ver hacia otro lado.
    el infierno vasco ??? eso es lo que provocaron tus amigos nazis en guernika, todos conocemos las consecuencias. lo que tu deberias ver es “la pelota vasca” y ver que no todo los que piensan como tu quieren romper españa. tolerancia, eso es lo que te falta.

  93. todos los que No piensan como tu, corrigo.

  94. Putoloco:

    La pelota vasca ya la he visto y es bodrio que nivela a las víctimas con los asesinos, como si fueran iguales.

    En fin, y lo de mis amigos nazis, bromeas, ¿no?

    • No bromea nadie contra tus amigos nazis hay que ir en serio. Las víctimas son llos vascos. Las hay pasivas y las hay activas. Es lógico que a tí, como agresor,no te gusten las víctimas activas.

  95. tu crees que bromeo ??
    no se que te crees, pero es la imagen que das y es lo que la gente piensa de ti, a mi me daría que pensar.

  96. Putoloco:

    Será la imagen que tú quieres ver en mí, no la que doy.

  97. ya, ya. haz una encuesta

  98. Putoloco:

    Buena idea. No tengo sitio para nuevos Widgets, pero si quieres puedes hacer la encuesta en tu bitácora.

  99. claro que si, yo pongo en mi blog ” Es SINBLANCAPORELMUNDO un fascista ??” y como nadie tiene ni puta idea de quien eres, pongo un link a tu pagina para que la gente vea que clase de personaje eres y así incrementar tu numero de visitas que total , al fin y al cabo es lo unico que buscas. así como agitaba el pp buscando votos con la crispación, buscas tu visitas con su misma estrategia. jaja. a ver si para las proximas elecciones te eligen jefe de campaña.

  100. Putoloco:


    Eres un cachondo, Locoputo.

  101. El catalán no es un puta mierda, ni lo es el húngaro, ni el letonio, ni el navajo… Los son los políticos cutres y con ciertos ramalazos racistas que utilizan una simple lengua para separar a la gente.

    • Ni los defensores del navajo, el catalán o el euskera son racistas ni pretenden separar a la gente. Eso lo hacen los que utilizan el castellano con otro nombre (español) para oprimir a los demás de forma racista. Por eso se unieron a Hitler y Musolini contra vascos y catalanes entre otros.

  102. Retroferran:

    Bienvenido a mi casa.

    Esos políticos no existen en el PP, existen en los partidos naZionalistas con la imposición del cat en todos los órdenes.

    • Los que son nazionalistas son los españoles del PP que imponen el castellano, con otro nombre, en todas partes y son hijos de los aliados de Hitler y hacen videojuegos dispàrando a emigrantes (porque son tan nazis y racistas como hitler o el Ku Klux Klan) y contra catalanes porque nunca han sido ni seran tolerantes con la gente y con el mundo puesto que su eóísmo y sus ansuas de explotarnos económicamente son su forma de vida para estos parásitos de la clase obrera.

  103. No entiendo este tipo de títulos para un post.

    Para qué lo hace? Para intentar provocar? Para intentar conseguir más visitas? Para debatir realmente en serio sobre un tema?

    No se, a mi desde luego se me quitan las ganas.

  104. SinBlanca, que tu no veas o no huelas la mierda no implica que no exista.

    Políticos cutres y con ciertos, y mas que ciertos, ramalazos racistas, homófobos, sexistas, nacionalistas y muchos mas, los hay en el PP en la misma proporción (o mayor, si cabe, si atendemos a la epidemia de caciquismo, chovinismo y provincianismo que invade a nuestra clase política) que en el resto de formaciones.

    Por supuesto siempre puedes negar la mayor o acudir al ytumasismo. Puedes incluso negar tu PPfilia y poner una vela mas a Dña Rosa, pero, sigue viéndosete el plumero a kilómetros.

    Y como dice Gallego, se le quitan a uno las ganas.

  105. Gallego:

    Los títulos así no es para provocar, al menos no para provocar en el sentido negativo, más bien para provocar la atención.


    No sé cómo entender tu acusación. La pluma que se me ve es la defensa de la libertad y de la igualdad para todos, no otra.

    Gallego, Wulf:

    Decidme cómo tengo que criticar a z y a sus amigos independentistas para no ofenderos.

    • Para empezar podrías leer libros de verdad y no la historia joseantoniana ni el mein kampf que tanto destila en sus nefastos discursos.

      Dejar de repetir las consignas de Losantos e intereconomía,… Actúar como si tuvieras cerebro propio.

      Aprender a respetar a todo el mundo , dejar de imponer a todos tu lengua por cojones y derechos de conquista.

      Anteponer la humanidad y el respeto a tu egoismo, a tus ansias de dominación cultural, social y político-económica, a tu repugnante superioridad que obliga a los demás a hablar como tu.

      El día que consigas hacer tal cosa será el día que no querrás escribir estas memeces y mentiras que ahora defiendes.

  106. Tal y como le dije en mi blog, la única atención que me provocan, por lo menos a mi, es la de desánimo.
    Pero le auguro mucho éxito en sus “provocaciones”. Es lo que, desgraciadamente, se lleva en estos días. Pero conmigo no cuente.

    En cuanto a lo que me pregunta, criticar a z y a sus amigos independentistas para no ofenderme, creo que se equivoca. A mi no me ofende que usted intente insultar a z, al catalán, o a quien le de la gana.
    A mi no me ofende, repito.
    Insulte usted a quien quiera. Lo que yo no hago es, ante quien insulta, perder mi tiempo con argumentos (sean estos verdaderos o falsos, tenga yo razón o no). Por eso me desanima.

  107. Gallego:

    Ay, Dios mío, bendito. Si yo no insulto. Soy cañero, muy cañero; puedo ser hasta duro y tal vez un poco generalizador, pero insultar no hago.

  108. Usted opina que no, yo opino que si.

    Para mi, decir que el catalán es una puta mierda es insultar al catalán. Para usted no.

    En su blog escribe un tal fanfatal que se dedica a insultar constantemente.

    Yo ya he visto en este blog todo lo que tenía que ver. En nuestro primer encuentro le di “el beneficio de la duda” y seguí leyéndolo. Pero esto cansa. Es la misma cantinela que llevamos escuchando de Losantos durante 4 años. Insultos, manipulaciones, mentiras y demás.

    Pues que se la coma usted con patatas. Yo en este juego no participo. Corto y cierro.

  109. amen, gallego

  110. Gallego, Wulf:

    Pero es que tenéis la piel tan fina como una recién nacido.

    Es sólo un título para llamar la atención. Si os quedáis en eso y no leéis el texto, que es la sustancia, entonces no sé qué pensar.

    No sé que hay de manipulación en la persecución de los castellanohablantes en Cataluña. Es un hecho: Multas, no uso del castellano en las instituciones, falta del derecho a la enseñanza en la lengua materna, discriminación en el trabajo por motivo de la lengua…

    Eso es lo importante. No el título que os ha hecho leer el artículo.

    • El 90% de las multas lingüísticas son para gente que no redacta en castellano. No reciben los avisos ni las prólogas que reciben los excusivistas del “español” y tienen penas más graves però, claro, a la hora de quejarse tienen la brunete mediàtica que los quatro fascistas privilegiados tienen.
      El catalán y el castellano deberían ser lenguas iguales ante la ley. No lo son porque hay discriminación del catalán empezando por la obligatoriedad de el castellano y la “cooficialidad” o “derecho a hablar” catalán. Esto se dá por una anormalidad genocida de 40 años llamada fascismo.
      Cuando vas a cualquier país aprendes la lengua y es positivo. En Catalunya hay 2 pero, nada menos, la que no es propia de allí es la obligatoria. Una cosa que consideran muy nnormal aquéllos que, lejos de amar a todas las “regiones españolas” como repiten incansablemente, lo que hacen es considerarlo parte de su feudo y por tanto son los autóctonos quienes deben hablar la lengua del amo y no hacer nada para cambiarlo.

  111. Ya te contesté al texto, lo que deja tu memoria en no muy buen lugar. Luego, he seguido leyendo mas textos y tus contestaciones a los comentaristas.

    ¿Piel fina?, ¿y qué?, valiente chorrada 😀
    ¿Que debo hacer con eso?, ¿sentirme ofendido, sacar mi macherío del armario y arremeter como un toro furioso (este comentario es lo mas que sale)?. Permite que me descojone 😀

    Partiendo de la base de que, en mi humilde opinión, tu vision del mundo y la realidad se parecen tanto como un huevo a una castaña, esa apreciación tuya tiene poco valor. Menos que poco 🙂

    Eso ultimo es ser (mas o menos) cañero, decir que tu blog es una puta mierda es insultar. La diferencia existe mas allá de la percepción personal. 🙂

  112. Per tu, el teu país és Espanya, però per d’altres el país és Catalunya. És qüestió de sentiments i punt, i no hi ha res per apel·lar. No cal aprofundir-hi més perquè qualsevol altra cosa són ganes de tocar la voraviu.

    Traducción de Sinblancaporelmundo:

    Para ti, tu país es España, pero para otros el país es Cataluña. Es cuestión de sentimientos y punto, y no hay nada que apelar. No hace falta profundizar más porque cualquier otra cosa son ganas de hablar hiriendo los sentimientos.

  113. Wulf:

    Si me dices que te parece una puta mierda, no me insultas. Yo te entendería, pero pensaría que no serías muy fino, que te faltaría capacidad de expresión.

    Te agradezco que a pesar de todo, me hayas seguido leyendo. Eso quiere decir que algún interés he despertado en ti, aunque sólo sea para constatar que mi visión del mundo y la realidad se parezcan como un huevo a una castaña.


    Benvinguda a casa meva.

    Una lástima que no dejes vínculo a tu página electrónica.

    Bueno, es posible que tengas razón.

    Yo no quiero que dejes de sentir lo que te da la gana. Allá tú. Lo que yo quiero es que no pienses que por ser catalanohablantes tienes más derechos que yo en Cataluña; que pretendas que todo sea en catalán para que los castellanohablantes tengan menos oportunidades a la hora de encontrar empleo, por ejemplo. Que los castellanohablantes se sientan ciudadanos de segunda porque no pueden mandar a sus hijos a una escuela en su lengua materna. Que TODO esté únicamente en catalán, obviando que la lengua castellana es también oficial en Cataluña.

    Sheika, sé lo que te dé la gana, pero no me obligues a mí a ser catalán, ¿vale, maca?

  114. Pero simblamca mi amor, tu eres ingles, comes pagas tus impuestos (supongo como todo ciudadano , al igual que los Españoles, aunque no lo sean legalmente, o sea no tengan nacionalidad pero pagan sus impuestos correspondientes no se que rollo le estas soltando a Sehika claro que puede ser lo que le de la gana, por eso en Cataluña tenemos un presidente, que habla el Catalán peor que mi madre cuando Hacia 6 mese que vivía en Cataluña y sabes no pasa nada lo único son personas que aunque vivan como tu en las quimbambas pretendan dirigir Catalaña, salud compañero que te vaya bonito ¿no se cuanto llevasen inglaterra? pero tu realidad de Cataluña es absurda , ahora que no hay problema te quedas donde estas y no das por culo a los demás

  115. Gallego: Aquí el único que insulta la inteligencia del resto, es usted, que no se molesta en leer siquiera el post, su sectarismo no le deja ver más. Y para usted la discrepancia es insulto y la libertad de expresión también, eso es lo que le molesta tanto.

    Pues aguántese si le molesta la pluralidad.

    Sinblanca: Si puedes conectar con la Otra de Telemadrid, hay un debate muy interesante sobre la opresión hacia los castellanohablantes por parte del gobierno NaZional-socialista.

    • El 90% de las multas lingüísticas son para gente que no redacta en castellano. No reciben los avisos ni las prólogas que reciben los excusivistas del “español” y tienen penas más graves però, claro, a la hora de quejarse tienen la brunete mediàtica que los quatro fascistas privilegiados tienen.
      El catalán y el castellano deberían ser lenguas iguales ante la ley. No lo son porque hay discriminación del catalán empezando por la obligatoriedad de el castellano y la “cooficialidad” o “derecho a hablar” catalán. Esto se dá por una anormalidad genocida de 40 años llamada fascismo.
      Cuando vas a cualquier país aprendes la lengua y es positivo. En Catalunya hay 2 pero, nada menos, la que no es propia de allí es la obligatoria. Una cosa que consideran muy nnormal aquéllos que, lejos de amar a todas las “regiones españolas” como repiten incansablemente, lo que hacen es considerarlo parte de su feudo y por tanto son los autóctonos quienes deben hablar la lengua del amo y no hacer nada para cambiarlo.
      El único nazi eres tú.

  116. jajajajajaja
    Llàstima que no n’hi hagin molts més com tu que es decidissin a posar per escrit la merda que vomiten!
    Gràcies per abonar el nostre discurs independentista, “sopaletu”!

    Traducción de Sinblancaporelmundo:

    ¡Lástima que no haya muchos más como tú que se decidieran a poner por escrito la mierda que vomitan! Gracias por abonar nuestro discurso independentista, !so paleto!

  117. Fanfatal:

    Lástima. Me quedé sin ver un debate que sin duda habrá sido muy interesante. Es estupendo que la gente se esté empezando a dar cuenta de la dictadura naZiolista. Vamos a ganar, nen.

    Ferran Pruneda:

    Benvingut a casa meva.

    Espero que haya más gente como tú que hable claro de verdad a Barselone i a Madrit.

    Para tu discurso de la ley del embudo, de la dictadura, de la ley de las pistolas en las sienes, de la opresión de los no naZionalistas, no me necesitas, guapín.

  118. Doña Letizia se atreve con el catalán

    La princesa de Asturias elogió anoche la iniciativa y el trabajo de las mujeres emprendedoras en la XI edición de la entrega de premios de la Fundación Internacional de la Mujer Emprendedora (FIDEM), en su primer acto en solitario en la ciudad de Barcelona. Durante su discurso, se ha atrevido a subrayar EN CATALÄN que Cataluña resalta desde hace muchos años “por la tarea de sus mujeres emprendedoras, que abren y gestionan sus negocios y comercios en zonas rurales y urbanas”.

    vaya, ahora resulta que la casa real fomenta el antiespañolismo. cachis

  119. Putoloco y nunca un seudónimo ha sido mas acertado, lo que diga esta señora nos trae al parió , pasamos olimpicamente de ella y de toda la casa real. no nos hace falta que nos vengan hacer la pelota manque te pese putoloco som i serem i no lo dudes si podem us futarem (a tal escrito tal contestacion, es lo que se merecen los mal educados,)

  120. Putoloco:

    ¡Qué bien! ¿verdad? ¿he dicho yo que hablar catalán signifique fomentar el antiespañolismo?


    Uff, qué mala eres con el pobre Putoloco. Si además es de los vuestros…

  121. Comentario injurioso trasladado a Cubo de la basura.

  122. Más de lo mismo… Sinceramente, me has aburrido bastante y no me has aportado nada que valga la pena retener. No creo que vuelva a aparecer por aquí, no vale la pena malgastar el tiempo con personas que se retroalimentan a base de sus propios prejuicios sin fundamento alguno. Nada más.

  123. Solo debo decir que nadie obliga a escribir en catalán de Barcelona a los valencianos. El estándard catalán no es el dialecto barcelonés. Hay palabras que dicen los valencianos que no son correctas, al igual que hay cosas que digo yo (barcelonesa) que tampoco lo son. Lo mismo pasa con el castellano. Pero claro, esto vosotros no tenéis porqué saberlo.
    Del tema de la persecución del castellano en Catalunya no voy a hablar. Defenderé hasta siempre que el catalán debe ser la primera lengua en la enseñanza en Catalunya, Balears y València; eso sí, sin dejar de aprender el castellano. Yo soy catalanohablante y sé hablar castellano perfectamente, que se me nota el acento, sí, como a muchos otros. Cuántos castellanohablantes en Catalunya pueden decir lo mismo del catalán?

  124. Raquel:

    Bienvenida a mi casa.

    Tu mateixa, maca.


    Bienvenida a mi bitácora.

    Desgraciadamente la lengua que se ha obligado a enseñar en el Reino de Valencia es el català normatiu. Eso es una realidad.

    ¿Y por qué no 50% catalán y 50% castellano?

  125. Evidentemente se ha enseñado el catalán normativo, faltaría más. Igual que se enseña el español normativo y nadie lo pone en duda. Yo sólo he dicho que el catalán estándard no es el barcelonés.
    No se debe cambiar nada porque si el sistema no funciona no es en contra del castellano, no funciona el enseñamiento del catalán. Cuando todas las personas que han estudiado en las tres comunidades catalanohablantes sepan el catalán igual de bien que el castellano, ya hablaremos. O es que conoces alguién que no sepa hablar castellano? Y cuantos hay que son incapaces de mantener una conversación en catalán (aunque hayan nacido en Catalunya)?
    Para mí es evidente que se debe hacer. Y en esto no voy a cambiar de opinión porque tengo muy claro qué considero mi país y cual es mi lengua, y tengo muy claro cual es el futuro que quiero para mis hijos respecto a este tema.

  126. María, Rosa (y otras): Nadie ha dicho que el estándar catalán sea el dialecto barcelonés, faltaría más. Sólo que se ha tendido a considerarlo como estándar para su uso normativo, sin tener en cuenta lo que ustedes consideran variantes del catalán. Ya expliqué mis problemas al utilizar el catalán “de les comarques del Sud del País Valenciá” en la illa de Eivissa. Yo hablando en valenciano y ella en ibizenco no logramos entendernos. ¿Es esto la unidad de la lengua? Para mí que no. Yo puedo entenderme con un argentino, con un miamense o con un guatemalteco incluso. A eso le llaman unidad de la lengua. Otra cosa es que se quiera imponer, per collons, un idioma ajeno llevándose por delante incluso la denominación. La falta de respeto de los pancatalanistas llega al absurdo. ¿Qué parte del habla valenciana es incorrecta? ¿Por qué se restisten a eliminar el “bueno” del catalán? ¿Porf qué tienen que corregirnos ustedes y no al contrario? ¿Por qué esa manía de adjudicarse como “catalán” cualquier hecho cultural valenciano? Por ejemplo, el Misteri d’Elx, por ejemplo, el Tirant lo Blanc. El pancatalanismo ha conseguido el efecto contario del deseado. Que valencianos con voluntad de integrarse en esa comunidad cultural se hayan ido en el sentido contrario. Y no hablemos de agua ni otras minucias. Ni de la política informativa de TV3. Que no nos quieran tanto.
    Sobre la filosofía del catalán actual es muy significativo analizar un palabra. Se trata de “plata”. Esta palabra pasó del catalán al castellano y al portugués. Cuando se normalizó el catalán para borrar toda huella “espanyola” se adoptó el término argent, que es correcto, pero es que el catalán ya tenía una palabra para denominarla.
    Y, aunque ya lo había dicho antes, es una pena que una lengua, el catalán, haya dejado de ser un instrumento de comunicación para convertirse en un muro.

    • Esto que dices esabsolutamente falso. E catalán es un instrumento de comunicación solo lo conideran un muro aquéllos que quieren derribarlo. Los fascistas (pero los de verdad, no lo que decís ahora los acólitos del neonazi Losantos)

  127. Perdona, pero por ahí arriba hay un comentario que dice que en valencia se impone el catalán de barcelona.
    Sinceramente, no veo que problemas tiene la gente para hablar con gente de otros dialectos: tengo amigos en muchos puntos de habla catalana y si bien al principio cuesta entender algunas palabras o acentos enseguida se entiende bien. Soy de barcelona, y vivo en Menorca y no tenemos ningún problema de entendimiento, te lo aseguro.
    Claro que si no estás acostumbrado cuesta entender-lo, pero también cuesta entender un andaluz y nadie niega esta unidad.
    Plata es perfectamente correcto, yo siempre la he utilizado. Otra cosa es que se adapte también el cultismo, en este caso argent.
    Para mí catalán no es solo lo de Catalunya. Si digo que catalán es solo lo que hace referencia a Catalunya es evidente que no diré que tirant lo blanc lo es. Pero como que yo creo en la unidad de la lengua, creo que el Tirant es catalán, de la misma manera que lo es Ramon Llull o Mercè Rodoreda. Sin negar que no son de Catalunya.
    (Por cierto, Maria sin acento, gracias)

  128. Maria:

    De lo que muchos valencianos no quieren ni oír hablar es de la entelequia de los Països Catalans. Ustedes abominan del “imperialismo” castellano, pero bien que se quieren zampar los antiguos reinos de Mallorca y de Valencia.

    Muy señora mía: Si usted quiere que su hijo aprenda sólo en catalán o en suahili, que lo haga, pero no obligue a los que no son sus hijos a convertirse en catalanets que odian a España como el sistema educativo catalán hace.


    Has regresado con fuerza al ataque.

    Estos catalanes son incurables. Lo único que les curará será el que pasemos de ellos de una santa vez.

    • Esto que te tanto te deprime de los catalanes sucede porque llevan razón y tú no.
      Además Los catalanes no somos pancatalanistas como dice el neonazi de la COPE Losantos al que tanto te gusta repetir como un loro. Somos catalanes y punto y los españoles nos dividieron y nos prohibieron mantener contacto. Esto todavía lo hacen los fascistas del PP como Camps cerrando las antenas de repetición de la TV3 pagadas por los propios vecinos catalanes de Valencia (los valencianos que sí saben en qué país viven).
      No vengas con tantas mentiras porque los únicos imperialistas de Valencia sois los españoles y no nosotros, ¿como vamos a ser imperialistas de nuestro propio país? ¿Acaso Madrid es imperialista de Cáceres? Pues Valencia y Catalunya igual.
      Valencia era catalana en el siglo XIII, Granada no fue castellana hasta fines del siglo XV (1492) ¿qué hablas tu de pancatalanismo o imperialismo catalán?,.. si el único imperialista eres tú.

  129. Ahora parece que aprender catalán es sinónimo de odiar España. Que grave error. Tengo muchos amigos que hablan catalán en su casa y se consideran muy españoles. Incluso hay catalanohablantes que votan el PP. Sí, no todos los catalanes que hablan catalán son independentistas. Que cosas, eh? Mira por donde, el sistema educativo catalán no hace que se odie España.
    Por cierto, creo en los Països Catalans, pero nunca lo haría por la fuerza. Si hay valencianos que no quieren formar parte de eso me parece bien, pero yo tengo derecho a creer en lo que quiera, siempre por la vía del diálogo. Una de mis mejores amigas es española y monárquica, yo no, pero esto no es motivo para que no nos queramos.
    Y no tendríamos tanta tirria a España si se aceptarán mejor las diferentes culturas y lenguas que hay; y si no se hicieran escritos como el tuyo con estos comentarios tan tolerantes.
    Podéis pasar de nosotros, sin ningún problema, no me va a molestar. Pero si tanto os molestamos por qué no nos dejáis ir tranquilos? O no somos tan problemáticos?

  130. Maria:

    Ya os digo: Os tomaré en serio cuando retiréis el Barça de la Liga Española y las oficinas de la Caixa de la esquina de mi barrio. Entonces os tomaré en serio, si no, me pareceréis los naZionalistas simples, que no ximples, fanfarrones y tocapelotas (con pendón)

  131. Maria (sense acento): ¿Qué son els Països Catalans? ¿Porqué no els Països Valencians o Balears? ¿Que tal els Països Alguerers? ¿A que mola?
    Pues bien, esa entelequia sólo la desea en la Comunidad Valenciana Eliseu Climent y otros cuantos subvencionats. El primero con su Acció Cultural (casi dos millones de euros de parte de la Generalitat Catalana el año pasado) dando la matraca cada vez más solo. Desde el Principado no se quiere ver la realidad y si no, fíjese en TV3 y su insistencia en llamar a esta tierra “País Valencià”, mientras que Alicante no es Alacant sino “les comarques del Sud del Paìs Valencià).
    Además, ¿para qué querriamos formar parte de esta entelequia si ni agua nos quieren dar? Pues de lo otro, que se lo queden. To pa ellos. I de res.
    P. D.: tienes razón, cuesta entender a un gaditano, a un granadino e incluso a algunos sevillanos y cordobeses. Pero esto suele ocurrir con el habla coloquial, o, mejor dicho, vulgar. Cuando es gente algo instruída, no hay problema alguno. Por cierto, los murcianos también tienen tela..

    • Rubén, la primera formación de una administración catalana empezó por el norte y se les dió éste nombre. Luego reconquistaron Valencia y Mallorca a los musulmanes en el siglo XIII.
      Ellos hablan lengua catalana.
      Granada fue reconquistada a finales del siglo XV (mucho después, ¿no?) y ¿verdad que hablan lengua castellana? vuestra lengua es la castellana, no la andaluza ¿verdad?,…pues ahí tienes la respuesta a tus estúpidas preguntas.

  132. Rubén:


    ¿Por qué tienen tela los murcianos?

  133. Senyor Ruben. No soy favorable al uso del concepto Països Catalans.

    El único país es Cataluña. Un concepto mas correcto sería Gran Cataluña, sin complejos.

    País Valencìà tambien es un concepto equivocado. Si a caso Regió Valenciana. Y tampoco, que a los alicantines no les gusta mucho. Mejor Región Alicantina.

  134. Miquel:

    Uff, qué tufo tiene eso de Gran Cataluña, como Gran Serbia, Gran Albania, Gran Alemania, Gran Israel…

  135. ¿Por el Imperio hacia Dios? ¿Deutchland über alles?
    Te has arretratado. Nada más que decir.
    O dices alacantí o dices alicantino. No te quedes a medias, maco.
    Alicante pertenece a la Comunidad Valenciana, y a mucha honra.
    Y tú ¿de quién eres?

  136. Yo soy Catalán. Y no, nada de imperios. Yo a diferencia de los simpáticos españoles no quiero expandirme ha´cia otors paises.

    No quiero ni lo que es parte de mi propia nación (la catalana): la región Valenciana/Alicantina/Castellonina/Ademusina/Torrentina.

    Como explico en mi blog considero que los que negais la evidencia, que formais parte de la nación catalana, teneis autoodio y no tengo ningunas ganas de perder el tiempo convenciendos.

    Solución: independencia para una parte de la nación catalana (principado de Cataluña y quien quiera) y los que no, pues que os den.

  137. Te sigues arretratando. Menudo cacao mental. Como si Carod-Rovira se tragara el bigote.
    ¡Catalonien über alles! Pèro ja, collons!

    • En realidad el Valenciano Josep Guia, fundador de lo que fue Catalunya Lliure y las juventudes Maulets (los últimos resistentes populares de Valencia a Felipe IV, quinto de Castilla) advierte que Valencia y Mallorca son Catalunya porque solo es un país. En realidad Maulets es la organización,nacida en Valencia, con más arraigo a la denominada por los españoles comunidad autónoma de Catalunya.
      Naturalmente no consideramos para nada que nos esten invadiendo gente de nuestro propio país. Tenemos muy claro que los fascistas invasores son los imperialistas españoles que siempre han procurado dividir nuestra unidad inventandose la lengua valenciana, clausurando repetidores de la TV3, olvidando el corredor mediterraneo, etc.

  138. Grandes argumentos, señor Ruben. Me has dejado mudo.

    Tu si que te retratas…

  139. Ehm… ¿I a Catalunya y a España que les importan tus decepciones de juventud?

  140. Moz:

    Bienvenido a mi casa.

    Bueno, chico, supongo que res de res. Pero yo cuando escribo un artículo, lo hago siempre desde mi punto de vista personal e incluso emocional.

  141. ¿Acaso los tuyos son argumentos? A mí me parecen delirios de los dominios catalanes del Mediterráneo. Roger de Lauria agitado con Joel Joan.
    Los míos los he expuesto en anteriores escritos. Te los lees y luego me contestas. Por mi parte, los tuyos me dejan sin palabras. ¡Es que no hay por donde cogerlos, pijo!

  142. Ni tanto ni tampoco, los que dicen que el catalán no sirve,tampoco es eso , es una lengua y hay que respetarla.Pero también los que dicen que con el español no se va a ningún sitio,también se pasan varios pueblos.y solo nombran lo que le interesa.Yo viajo mucho a nueva york (capital del mundo) y el inglés casi ni lo uso. Si eso no es servir pues nada .allá cada cual con su localismo.

  143. compañero yo como catalán me siento ofendido con el título de tu post, no todos los catalanes somos como carme chacón o como maragall, o como ridao o carod rovira, o como el actual laporta, creo que no hay que generalizar, en cataluña habemos muchísima gente que nos sentimos catalanes y españoles que por otra parte viene a ser lo mismo, porque cataluña pertenece a españa, que no se te olvide…

  144. Hola, no soy Española ni Catalana, soy Chilena y vivo en Girona hace ya casi dos años. Mi primera impresión acerca de los catalanes fue que era gente cerrada y de muy mala onda. pero como en todo no se puede generalizar, al ir conociendo gente me he dado cuenta que si sabes llegar a ellos son personas preciosas. Con respecto al catalán es normal que quieran cuidar su idioma, si cada vez Cataluña se ve mas invadida de inmigración es lógico que quieran conservar su idioma. Yo personalmente no hablo catalán simplemente porque no me siento comoda, pero he tratado de aprenderlo y entender cuando me hablan para asi poder decirles a ellos que no cambien el chip de hablar en Castellano y sigan en catalan.

  145. Ciudadano:

    Bienvenido a mi casa.

    Yo no valoro el catalán por su importancia numérica. Me dedico a defender mi lengua materna como lo hacen los naZionalistas -de los cuales muchos ni siquiera son catalanohablantes-. Yo por defender mis derechos soy un fascista; ellos, sin embargo, por lo mismo son súper progresistas y súper demócratas.


    Te entiendo. Puede ofender, pero no se te olvide que no es más que un título para incentivar la lectura de un artículo.

    Yo no digo que haya catalanes decentes como tú; ahora bien, o hablan bajito o están muertos de miedo.


    Bienvenida a mi casa.

    Su actitud me parece la normal.

    El caso es que ya no se trata de “cuidar” el idioma -que ya está más que cuidado-; se trata de imponer el catalán en todos los aspectos de la vida, discriminar a los otros españoles por no saber catalán e indoctrinar en las escuelas el odio a España.

    Siendo usted chilena, imagínese que en las zonas mapuche se obligara a imponer el mapuche como aquí se hace con el catalán y además en las escuelas y en los medios de comunicación se enseñara el odio a Chile. Haciendo ese símil usted me comprenderá mejor.

    Encantado de conocerle y yo soy de los que piensa que Chile es un país hermano. No como los naZionalistas que la ven a usted como una sudaca invasora -palabras de los naZionalistas-.

    • Pues claro. Nosotros no somos imperialistas que vamos a Sevilla y les decimos que hablen catalán porque si siguen empeñados en hablar castellano son unos nazis como haces tú con nosotros, tergiversador.

  146. És ben trist que un blog com aquest tingui tantes visites. Els catalans hauríem de parar més compte amb ço que llegim. Jo evidentment no m’he llegit un text amb un títol com el d’aquest.

  147. Bajo el punto de vista que me lo planteas claro que no me gustaria que llegaran los mapuches a imponer su idioma al resto de las regiones de Chile. A grandes rasgos hemos sabido conllevar nuestras diferencias.
    Y claro que tienes razon que la gran mayoria de los españoles en general nos ven como sudacas invasores, yo creo que la tortilla se ha dado la vuelta, tal vez nuestros indios sintieron lo mismo cuando fueron invadidos por los españoles. Pero eso es historia muy añeja y entrariamos en un tema que manejo muy por encima. El resentimiento entre españoles y catalanes lo encuentro una verdadera perdida de tiempo, si al final el dni los muestra a ambos como una misma nación les guste o no para fuera del mundo a los catalanes se les conoce como españoles, en Chile a cualquiera que marque mas una Z les llaman gallegos. yo creo que lo mas importante es el respeto por ambos lados, nadie debe imponer nada.
    Te invito a que te des una vuelta por mi blog, seria muy agradable

  148. juajuajua!!!!! –> Encantado de conocerle y yo soy de los que piensa que Chile es un país hermano. No como los naZionalistas que la ven a usted como una sudaca invasora -palabras de los naZionalistas-.

    • Los nazionalistas son los españoles que impuysieron su lengua castellana en Chile y eliminaron las de los diferentes pueblos y que se portaron allí de una forma tan racista como todavía hoy te portas tú votando a cerdos que claman para echar a los emigrantes como el PP.

    • Eres un hipócrita, fascista.

  149. claudia, tú que vives en catalunya supongo que habrás visto que catalanes hay de todo tipo, como en todos lados.. confío en tu buen criterio para entender qué tipo de blog es éste. un saludo.

    • Claudia, como persona intligente que es, sabe perfectamente que quéreis hacernos a nosotros lo que les hicistéis a ellos, imperialista.

  150. jo com a catalanoparlant de Mallorca mhi donc per eludit…
    Crec que tenim tot el dret de defensar sa nostra llengo!
    A ca teva no poder xerrar sa teva llengo o fins i tot ser insultat per fer-ho, fa mal!

  151. Esta bitácora SI que es una puta mierda. El odio no sirve para nada, hermoso.

  152. El odio no sirve para nada, y en su casa cada uno habla lo que le da la gana, lo que ha vivido y nadie tiene derecho a decidir lo que hemos de hablar el Catalan mal que pese es la lengua natural de Cataluña y aunque a muchos les pese es asi, es absurdo odiar la lengua del lugar que vives, ¿pero que se puede esperar, de unas personas que montan una feria de Abril subvencionada en Santa Coloma y en cambio rechazan una Jaima pagada por el ministerio de turismo Marroqui? ni pidas a quien pidio, ni sirvas a quien sirvio.¿acaso la Jaima no tiene derecho a ser montada por ser Marroqui ,pagando los Marroquis y las casetas si, por se Andaluzas? aunque las pagemos entre todos hasta los que no nos importa . Mal vamos

  153. Cada día me demuestran más y más el odio y la intolerancia de los nazionalistas catalanes, no se puede ser más paleolítico que esta gente que piensan que su pueblo es un país. Una pena que haya gente en Cataluña que no sepa hablar español y que sólo se defiendan en catalán, idioma que no sirve absolutamente para nada, lo mismo que aprender montonés o Maorí.

    • ¿Alguna día piensas decir algo que sea verdad o seguirás en tu mundo de mentiras nazis y fascistas que te enseñó Franco toda la vida?

  154. En Cataluña todos sabemos hablar Castellano, y si el Catalan no sirve para nada es nuestro problema no el tuyo, hace cientos de años que el Catalan, igual que otras lenguas de la peninsula se habal, no son para hacer la puñeta a nadie asi fue su evolucion del latin, lo que ocurre que la ingnoracia y mala fe de algunos es muy osada, por cierto tan Español es el gallego. el vasvuence, el Catalan etc, como el Castellano porque mal te pese son idiomas que se hablan en este pais, aprender cultura no esta de mas y a veces uno hasta no hace el ridiculo diciendo cosas que no son

  155. Sí claro, el catalán tiene la misma utilidad que el gaélico en Irlanda, osea nula. Y en Irlanda a nadie se le ocurriría prohibir en las escuelas o rotular en sus comercios en inglés, como sí ocurre en Cataluña.

    Si es que hasta los irlandeses son más inteligentes y menos garrulos y paleolíticos que los nazionalistas catalanes.

    A ver si aprendéis un poquito.

  156. no sera de ti ¿verdad? de tu gran cultura que hemos de aprender nos dejas anonadados, en Cataluña te sepa mal o no, me da igual hablamos la forma en que el latín evoluciono en nuestra tierra igual que vosotros lo hacéis en la vuestra, ¿que sois muchos mas millones que os expresáis en Castellano?pues muy bien ¿y que? yo no tengo ningún problema y me expreso igual en los 2 idiomas (entre algún otro) pretender humillar un idioma porque es mas débil es de analfabetismo lingüístico,pero discutir con algunas personas es perder el tiempo, cuando mi madre vino a Cataluña a los 3 meses entedia el Catalan y a los6 mese lohablaba alguien le comento ¿porque te molest y respondio lo que me molesta es no entenderlo,¡como se de que hablan? pero si a ti se dirijen en Castellano, si pero si entre ellos como es normal estan acostumbrados a expresarse en su idioma aunque directamente no hablen conmigo yo quiero esta en la conversacion. esto se llama saber lo que uno quiere y adaptarse al medio para vivir mejor, cuando ella llego ya hablaban Catalan no lo inventaron para hacer la puñeta a los que llegaban, o sea que es repulsivo este odio a un idioma que tiene el mismo derecho que otros

  157. Lo vuestro es garrulismo y catetismo a más no poder, no se puede imponer un dialecto que hablan cuatro catetas a un idioma como el Español que hablan más de 4oo millones de personas en el mundo. Al igual que en Irlanda no se impone un idioma como el gaélico por encima de el inglés que hablan millones de personas en el mundo, sería absurdo y como son bastante más inteligentes que los nazis catalanes, no se les ocurre hacer nada parecido, como negarles utilizar el inglés primando el gaélico que es un idioma regional y minoritario que sirve para comunicarse con cuatro irlandesas perdidas en algún pueblo.

    El nazionalismo cateto e ignorante se cura viajando y viendo mundo

  158. y el nazismo español y centralista se cura llendo a europa, de los pirineos para arriba y vemos que españa es un pedazo de mierda para los europeos, igual que para los norteamericanos, que piensan que somos unos chicanos y que malamente saben situar españa en un mapa debajo mismo de mexico, pero no saben si es encima de guatemala del salvador. anda ya, vosotros si que sois catetos. queria yo veros a vosotros viviendo en belgica, de verdad pensais que allí los flamencos y los valones están como “es que quieren romper belgica “”que se rompe belgica!!”” o en canadá, por ejemplo, que ya ha habido dos consultas para independizar Quebec, y las han perdido, y no ha pasado nada, siguen conviviendo en paz, no se acusan unos a otros de antipatriotas ni se consideran enemigos ni nada de eso…pero claro, aqui tenemos la herencia del fascismo, hay que hacerlo todo con el tiro en la nuca, como se hacia antes, en la españa francó-catolica. anda que, menuda panda de paletos.
    si en cataluña se habla catalán, pues habra que hablar catalan o quedarse en casa, cual es el problema ?? la impotencia de la gente de hablar un nuevo idioma ?? pues eso es lo que hay que curar, la ignorancia, a leer y a aprender, coño, que bien que aprendiamos aleman en 6 meses en los 60 cuando nos ibamos a trabajar a alemania. los aldeanos mas paletos del pueblo te llegaban hablando alemán, y ahora no somos capaces de hablar catalan……anda que, ya se os nota lo tolerantes que sois. ademas me parece que en la comunidad valenciana el problema es el mismo segun denunciaron en estos mismos foros uno que estudiaba en valencia y tenia que pagar 6000 para poder ir a una universidad hispanoparlante. coño, pues en valencia lleva el pp toda la vida y no decís nada. asi que ya sabemos a quien odiais, a cataluña, no al catalan, si es que no se para de veros el plumero…..

  159. A los que se os vé el plumero constantemente es a los paleolíticos nazionalistas, ya seais catalanes, vascos o gallegos. El ptoblema es que si tú quieres hablar un dialecto minoritario de mierda, lo hablas tú, no que me lo impongas a mi por encima de un idioma que habla más de mediomundo y encima se me multe por no rotular en el idioma de la tribu catalanista que se habla en una provincia.

    Lo del tiro en la nuca, es cosa más propia de nazionalistas catalanes como la banda terrorista Terra Lliure(ahora todos integrados en ERC) de ETA Y de independentistas gallegos.

    Lo que es cateto es querer imponer una lengua regionalista minoritaria, con la que no vas a ningún sitio fuera de las aldeas de cataluña, por encima de una lengua internacional que hablan más de 400 millones de personas en el mundo y la 2ª lengua de los USA.

    Es penoso y surrealista que se pueda estudiar español sin ningún problema en los Estados Unidos, Francia o Gran Bretaña, y en una región de España: Cataluña, no se pueda esstudiar en el idioma de tu país y te obliguen a hacerlo en el dialecto de la tribu nazionalista, por encima de el español.

    • Y los holocaustos nazis y las masacres en plazas de toros extremeñas o en campos de futbol de Chile de fascistas de mierda como tú, nazi. Que se te ve el plumero, nazi.

  160. bueno, pues de momento, como decia aznar a los de nunca mais, te digo lo mismo, vete a ladrar tu rabia por las esquinas. osease, en castellano para que me entiendas. a joderse y a tragar.

  161. ¿A tragar qué? tendrán que tragar los propios catalanes que viven bajo la dictadura nazi catalana que oprime a una región de España, como comprenderás en Madrid, no tengo porque aguantar a gentuza que impone una puta mierda de lengua que hablan cuatro garrulas al resto de las personas que resisten a esta especie de totalitarismo que tanto te gusta tarado.Osea, en Español para que me entiendas, porque tú de hablar catalán tienes lo mismo que Mr bean-ZP a su salida de Downing street hablando inglés.

  162. Me encanta, Putoloqui, cómo echas piedras sobre tu propio tejado. Se nota que no hablas ningún idioma aparte de tu lengua materna, a la que tan poco defiendes y amas. Pero eso es normal, también echas mierda sobre tu país y la libertad de tus compatriotas.

    Tu ignorancia es tan abismal que viendo cómo escribes llendo en vez de yendo, no me extraña en absoluto.

    Sólo espero que alguna vez te encuentres en esas partes de España que te niegan el derecho a tu lengua en las instancias oficiales, y que te jodas y tragues tu rabia como le aconsejas a Fan Fatal.

    Fan: Comparto al cien por cien tu defensa de la libertad de elección de lengua. Lo que ya no comparto es esa valoración de los idiomas según la importancia numérica de sus hablantes. Si los catalanahablantes quieren vivir sólo en catalán, allá ellos, a lo que no tienen derecho es a IMPONER dictatorialmente a los castellanohablantes su lengua como se hacía en la dirección contraria en el franquismo, con la aquiescencia de casi todos los cat, vas y gal.

    Fan: Es verdad lo que dices de la pujanza del castellano en el mundo. Sin embargo, esta sucede a pesar de los propios hispanohablantes. La mayoría de los hispanohablantes tienen una conciencia cultural NULA. De ahí que se dejen avasallar y no defiendan sus derechos.

    El ES tendría que ser junto al inglés y no el francés el idioma oficial de los organismos internacionales, pero no lo es por el poco empuje de los gobiernos de los países hispanohablantes.

    La desaparación del ES en Filipinas, por ejemplo, se hizo con la colaboración de muchos filipinos de lengua materna española que se dejaron comprar literalmente y que hicieron desaparecer a los que luchaban por una Filipinas independiente e hispana… Pero eso sería para toda una ristra de entradas que, dada mi apatía actual, deberán esperar.

    Así que Fan, no apeles a la importancia del ES, apela a los DERECHOS INDIVIDUALES de las personas y tu discurso se verá reforzado.

    Putoloco no es sino un analfabeto funcional con la conciencia cultural de un mosquito. Así va nuestro país. Pero, Viva España, carajo, todavía resistimos. Yo puedo estar momentáneamente con la candela disminuida, pero la llama está viva.

  163. ¿pero vamos a ver fanfantasma? a ti lo que hablemos lo demas te la repanfinfla o sea que quedate con tu Castellano y dejanos a los demas que hablemos lo que queramos, a mi me importa muy poco que ladres, berrees, ohables en morse, por lo que exijo que a mi me dejes hablar como yo quiera, por cierto, la mala educacion de los nazis Castellanos esta al orden del dia sois incapaces de tener una conversacion como seres humanos solo sabeis insultar claro que con los argumentos que aportais y la cultura que gozais se ha de notar, menos mal que sois una minoria porque por suerte cuando uno viaja no encuentra a nadi que le diga¿de donde eres? de Cataluña a pues el Catalan es una puta mierda, eso solo se atreven hacerlo a traves del anonimato, 4 acomplejados,

    “A tragar qué? tendrán que tragar los propios catalanes que viven bajo la dictadura nazi catalana que oprime a una región de España”
    je, dictadura dices, acaso no han votado los catalanes,no eligen ellos el gobierno que quieren???
    que coño van a tragar los catalanes si ellos lo que quieren es hablar catalan ??? no respetas los resultados democraticos ?? no, ya se vé que no, je, pues claro que ni soy catalan ni hablo catalán pero yo respeto que los catalanes quieran hablar catalan, tu de respeto no entiendes mucho.

    A mi no me hace falta ir a esas partes de españa donde no se entienden lo que dicen, vivo muy establemente en mi casa, pero si tuviera que ir, pues tendría que amoldarme como cuando estuve en belgica, en alemania y checoslovaqia…ah, no, que ese pais ahora no existe, que se ha roto en dos, menuda panda de antipatriotas. como son los checos.
    y si, la verdad que si, confundir una ll con y tiene delito. le espero en mi casa, al amanecer, para que venga a ejecutarme a la luz del alba como es costumbre en ese regimén politico que a usted le gustaría que instaurasen de nuevo.

  165. Rosa:

    Perdona, guapa, pero se me olvidó contestarte a ti también.

    FF puede estar equivocado en cuanto a la valoración del catalán como lengua, ahora bien, tiene toda la razón cuando critica la situación de los castellanohablantes en Catalunlla.

    La culpa no es tanto de los catalanohablantes, que también, sino de los castellanohablantes como tú, que acomplejados por provenir de otras partes de España, tienen que ser más naZionalistas que los catalanes, tan integradores ellos, denominan catalans de debò. ¿Cómo se dice también? ¿catalans de la seva, catalans d’arrel? Explícamelo, que no lo sé. Se dice catalans de la seva, de la seba… ¡Culturízame, Rosa!

    Te mando un beso, hermosa.

  166. castellanohablantes en Catalunlla.
    vaya, te ha traicionado el subcionsciente. es con Y, catalunYa, y digo yo, si los catalanes no quieren hablar catalan, porque no votan masivamente al pp ???

  167. Putoloco, majo:

    Ya me gustaría a mí estar mascando chapas por el mundo; me encantaría, no me importaría dedicarme a eso, si lo hiciera bien y fuera feliz. Así que en ese aspecto, has dado en hueso.

    Escribo Catalunlla a posta, adrede, con toda consciencia de lo que se hace, y además con intención, para mofarme de los gilipollas, boludos, pendejos, huevones, totorotas etc que cuando escriben en español, escriben Catalunya. Porque ellos lo escriben para meternos hasta por las narices que son una nación y otras pelotudeces por el estilo. Como los que escriben Girona en vez de Gerona etc, etc, etc.

    Putoloqui, un poco más de amor propio, un poco más de amor por tu lengua, cariño. Y eso que dices que quiero instaurar no sé qué… Guapo, eso no te lo crees ni tú.

  168. pero no me respondiste a lo que te pregunto. de que dictadura me hablais cuando es la mayoría de catalanes los que votan a partidos que favorecen ese sistema linguistico??

  169. Putoloco:

    Tienes razón. La gente todavía no se da cuenta porque los medios de comunicación catalanes no hablan de lo que verdaderamente ocurre. En Catalunlla hay manipulación y MIEDO a ser diferente porque si alzas la voz te sucede lo que al Profesor Caja, a Dolors Nadal o a Albert Rivera: El boicot, el ostracismo social… etc. Entonces la gente prefiere pasar de la política, quedarse en casa y no meterse en líos. En fin, como en la época de Don Paco.

  170. ah, don paco, que añoranzas, verdad ??
    seguro que tu ibas a recibirlo con los brazos abiertos si pudiese volver….

  171. Puto loco: Te repites más que el ajo. hijo, no sales de lo mismo, qué obsesión tienes con Franco. Majo, si tú ni habías nacido siquiera, majete, habla del presente y deja a Franco o a los reyes católicos en paz, si me apuras, porque si quieres podemos hablar de Largo Caballero o de Stalin si quieres, pero estamos en el presente, que es lo que nos ocupa y preocupa, asi que no desvies el tema con el tema-comodín de siempre

  172. ¿Qué dictadura? la del apaleamiento del no naZionalista, la multa, el repudio y señalamiento del que osa rotular en español, o te juntas a la tribu nazi por temor a que te apaleen y te hagan la vida imposible o te vas al exilio como han optado muchos catalanes para vivir en paz.

    ¿te parece poca dictadura?

  173. Putoloco, nen, ¡qué cansino es tratar de conversar contigo!

    Se te ponen vídeos en los que se queman banderas españolas, se explica que los niños no pueden ser escolarizados en su lengua materna -la tuya, nen, la tuya-, se te dice por activa y por pasiva que a los que rotulan sólo en castellano -en tu lengua, nen, en la tuya- les ponen multas, se te dice que se discrimina a la gente en el trabajo si sólo habla castellano -tu lengua, nen, la tuya- etc, etc, etc. Y a ti te da igual.

    Pues muy bien, algún día te darás cuenta de lo TONTO que eres. Y no te me pongas a llorar ahora porque te haya llamado tonto, ¿vale, guapo?

    Échale una ojeada al vídeo de nuestro Fan Fatal. A ver si tienes algo en las venas… y pofavó, olvídate de Franco y no me salgas con tonterías que ni tú, ni yo, hemos vivido, ¿vale, majete?

  174. pero vamos a ver, en que mundo vivís ??
    acaso no hay elecciones cada cuatro años ??
    no hubo elecciones en cataluña el año pasado ??
    como llamais dictadura a un gobierno elegido en votaciones democraticas ?? no aceptais los resultados ??
    si ellos votan eso, es porque quieren eso, el dia que no lo quieran pues ya votarán al pp, pero de momento me parece que no, cada pueblo tiene el gobierno que elige, o el que se merece así que no me vengais con dictaduras. acaso es dictadura lo de chaves en andalucia ?? no hace ni dos meses que acaban de votar, era dictadura lo de fraga en galicia, yo creo que no, que no era más que la voluntad del pueblo, pues eso es lo que no aceptais, la voluntad de los votantes
    por cierto, Fanfatal, no es que viviera de lleno el franquismo, pero tengo 38 años, haz tu las cuentas, no estás hablando con un niñato, yo ya estoy curtido de estupideces como las vuestras.

  175. por cierto, me suda lo de tonto, esa es vuestra estragia de siempre, el insulto y la descalificación con todos los que no piensan como vosotros. ya se sabe que solo tu y fanfatal sois los mas listos del cyberworld y los demas no somos más que una panda de ignorantes. que pena no haber nacido tan listo como vosotros para así poder ver el apocalipsis que se nos viene encima. no sé como soy tan tonto, a lo mejor es porque yo no trago semen como vosotros, quien sabe, pero bueno…que le vamos a hacer, ya que no queries debate, solo imponer vuestras opibnones sobre los demás, pues nada, ahí os dejo a los dos para que os comais las pollas mutuamente con vuestro anticatalanismo y os regocijeis en vuestro odio. yo, como no odio a los catalanes como vosotros,pues me abstendré de volver a participar en este debate.

  176. ¿Con 38 has vivido el franquismo?. vaya por Dios,porque yo con 40 no me acuerdo de nada.

    Por esa regla de tres, Hitler era un demócrata y su gobierno también, porque como salieron de las urnas y el pueblo lo votó….

    Chávez también salió de las urnas y sin embargo se está cargando la democracia.

    Es que gente dictatorial y autoritaria gane las elecciones, no les avala para que se carguen a la mitad de la sociedad que no les ha votado.

    ¡Vaya concepto que tienes tú de la democracia! cómo han ganado no se les puede criticar, ni denunciar las tropelías que cometen, anda que….

  177. Ah! una cosa es criticar a los naZionalistas catalanes, y otra ser anticatalanista, no sé cómo hacerlo para que lo entiendas.
    Que se podía estar en contra de Hitler y no ser antialemán, que se puede estar en contra de Castro y no ser anticubano.

    Asi que no mezcles churras con merinas. O acaso Albert Boadella o Sabino Méndez son anticatalanes?

    ¡Venga ya! a otro perro con ese hueso

  178. Niños, la rabia os ciega, si en Cataluña no quisieramos hablar Catalan no lo hariamos, pero como que nos da la gana de hablar el idioma natural (forma que ha evolucionado el latin aqui, al igual que en Francia, Castilla ,Portugal etc ha evolucionado de otra manera), hay cosas que estan muy claras, laCatalanofobia es un mal que padecen algunos personajes (¿es una alteracion genetica ?segun algun articulo leido a un intelectual dela talla de Ciudadanos, por lo visto si,) bien por lo visto tiene cura, el que padece ese mal solo con que se vaya de despeñaperros p’abajo se cura, tambien pasado Aragon, porque por alli aun hay vestijios y puede dar algun brote, o sea que ya lo sabeis el que tengan esta aletgia ya sabe lo que debe de hacer y su forma de actuar.

  179. No hija, no, que no te enteras de nada, que yo gracias a Dios, soy y vivo en Madrid, al igual que Sinblanca que vive en Londres, como verás tenemos la inmensa suerte de vivir en ciudades cosmopolitas, abiertas y modernas donde el naZionalismo no tiene nada que hacer,los que los sufren son los que lo denuncian, porque no tienen porqué aguantar que en su propio país se les niegue la educación en el idioma del país o sea el español, ni tienen porqué ser perseguidos, apaleados y multados por usar el idioma que se habla en su país. No sé si ahora lo coges, querida, y que no tienen porqué abandonar su comunidad porque haya gente tan intolerante como tú, que les hace la vida imposible y no les deja vivir.

    Me parece que la rabia y el odio os inunda a vosotros, impidiendo que el resto de catalanes puedan expresarse también en su idioma: El español.

    Como comprenderás, a mí me la trae floja, ya que no tengo la inmensa suerte de tener que sufriros. pero hay mucha gente que sí sufre vuestra violencia e intolerancia que sí vive allí y es igual de catalana, o más que los nazis que os gobiernan.

  180. No soy intolerante soy normal, nunca h efaltado a nadie por hablar Castellano, pero no me parece bien la falta de respeto de muchos intolerantes, por lo que ante un agravio me subo, yo vivo en un barrio multicultural de una gran ciudad, los letreros de las tiendas estan escritos desde chino hasta Paquistati, pasando por el Tamazig y mezclados con algo que parece Castellano “carneceria”por cierto de esto hay mucho, si todos los letreros que no estan escritos en catalan los hubiesen de multar te aseguro que ni en 2 meses terminan en mi barrio, hablais de oidas de que fulanito tiene un primo que tenia rotulado en Castellano pero le pusieron una multa y a lo mejor la multa se la pusieron por tener el genero en condiciones no higienicas (eso si es verdad por eso multan ) manos mal, que mi hijo no puede hablar Castellano en el colegio “mentira” mi hija, para junio hizo 18 años, a entrado en la universidad y hace 1º de magisterio, al terminar la eso hablaba y escribia correctamente el Castellano y el Catalan ademas de un buen nivel de Ingles, ningun niño “ninguno ” en Cataluña no sabe hablar Castellano es mentira, lo que ocurre es que como el PP sabe que aqui no se va a comer nada, nos tiene mania y va pinchando y pinchando para que el resto de Eapaña vea a Cataluña como la mala de la pelicula, y si no con el numerito montado entre sus filas por ellos mismos podeis ver lo que pueden llegar a ser, si la traicion anida entre ellos que no van hacer en beneficio propio contra quien les cierra el paso

  181. No, querida, de oídas no. es cierto que se multa por rotular en castellano, no por rotular en Chino o en paquistaní, esa es la diferencia, en cataluña en los colegios no se dan las materias en español sino que se dan en catalán y es imposible escolarizar a los niños en español, y no es de oídas, son los propios catalanes los que lo denuncian.

    Si es mentira que en Cataluña se multa por rotular en catalán, ¿cómo es posible que Mr Bean-Zp esté de acuerdo con que se multe a quien rotule en español?
    ¿estás contradiciendo a tu presi?


  182. Putoloco:

    Iba a contestarte, pero Fan Fatal se me ha adelantado con mejores argumentos. Yo además añadiría que en Catalunlla no hay democracia porque se vote cada cierto tiempo. Allí todos los poderes están copados por gente afín a los naZionalistas: La prensa, la radio, las empresas… Si levantas la voz en contra te ningunean y al final te echan como les ha pasado entre otros a Boadella o a Sabino Méndez. Si no quieres ver esto es porque te obcecas en tu progresismo antiespañol -¡qué curioso en el dos de mayo decir esto!- Tú no eres sino uno de esos afrancesados de antaño que vieron cómo masacraban al pueblo llano y no hicieron nada porque sus ideas eran las del invasor. Algún día te darás cuenta… Te recomendaría que leyeras los Episodios Nacionales de Galdós si no fuera porque no creo que pasaras de las primeras páginas de Trafalgar.


    A ver, guapa, tú no pareces comprender o entender tu lengua, que es el castellano y a la que das cien mil patadas cuando la escribes, por cierto.

    Nosotros queremos los mismos derechos y deberes para todos los españoles en todas partes de España. Tú deja que tu hija se eduque sólo en cat -que no es tu lengua, TONTA, que te están dando gato por liebre, XIMPLE- pero a mí dame la libertad de elegir en qué lengua quiero educar a mis hijos. Si tú quieres que a tus hijos se les enseñe que Catalunlla es una nació, allá tú, pero yo no.

    Además, ten en cuenta que se multa a los comercios que rotulan sólo en castellano, a los que rotulan en urdu o en chino les dejan en paz. Es que claro, se trata de borrar el castellano de Catalunlla.

    Ilústrate con el vídeo de Fan Fatal, maca.

    Y todavía no me has respondido a mi pregunta de si se dice “de la seva”, “de debó”, “de la seba” o cómo.

  183. A este ciudadano catalán le multaron con 400 euros por rotular en castellano su propio negocio. Debe ser que es anticatalán o que habla de oídas.


    Rosa, hija, que no nos engañas, bonita.

  184. ¡Qué tolerantes son los naZionalistas catalanes!, que piden hasta la cámara de gas para los catalanes díscolos como Boadella. si hasta para los métodos son igual los nazional socialistas alemanes, quie lo naZional socialistas catalanes


  185. Y tu ¿de que conoces a Boadella? anda ya ni pidas a quien pidio. ni sirvas a quien sirvio, eso es lo que ocurrre con Boadella mientras rebaño, callo y ahora como no rebaña, busca rebañar por otros lindares. Por cierto ayer fui al forum a la feria de Abril (pa que veas) y a parte de un letrero del psuc, la unica representacion politica era una caseta de ciudadanos es divertido ver hacer el ridiculo algunas personas, me hubiese gustado ver al Rivera y a Boadella marcarse un bailecito, que pena no habia ninguno, y ademas la caseta no gozaba de mucha asistencia¿porque sera? tenia mas asistencia la tienda de campaña Marroqui que el chiringuito de ciudadanos, ¿tal vez es que no habia ninguno en cueros?por cierto en la puerta ponia ciutadans, ¿en que quedamos o hablamos Catalan o Castellano? pero que no nos lien

  186. Será porque los queréis gasear. además de apalear como ya ha ocurrido en innumerables veces?

    El miedo es libre, y desde luego que hay que ser muy héroe para ponerte con un chiringuito que no sea naZionalista socialista en la Cataluña del Fuehrer Montilla Y Rovira, sin temor a que te apeleen o incluso te metan un tiro, como ya han amenazado a Rivera.

    Y como ya han hecho innumerables veces los terroristas de Terra Lliure, ahora reciclados en ERC.

    Por cierto, puedes hablar lo que te salga del potorro, pero no impidas que el que quiera rotular su negocio en español o el que quiera ser escolarizado en su idioma lo haga.

    De verdad, que Barcelona y toda la región en general se ha quedado muy atrás, una pena, cuando en los 70, no era como es ahora, que es lo peor.

  187. “Fan: Comparto al cien por cien tu defensa de la libertad de elección de lengua”

    ¿De qué oscura libertad hablas sinblanca?Porque me parece que lo que quereis fanfatal y tú es que gente que usa en su casa el catalán hable el castellano sólo porque ahora resulta que, el castellano GUAUGUAUGUAGUGUAUUUAGUAU (es que me resulta pesado repetir todos esos tópicos insanamente patrióticos sobre el orgullo de ser español. no veo orgullo en aplastar culturas con la lanza de la intransigencia. Si quieres que esos “naZionalistas” no ataquen tu idioma, deberías ser, al menos, honesto, y no atacar tu la suya. Pero no, tus armas son vanas repeticiones o cacareos de lo que nos llevan contando desde lo tiempos de la autarquía: España una, grande y libre, libre para quién quiera ser español, grande, uno y libre…libre de ser español, grande y libre…uf…menudo círculo vicioso, será verdad eso que decía Oscar Wilde, de que el patriotismo es la virtud de los depravados. y lo digo tanto para los españolitos debien y para los catalanes independents, tanto monta, monta tanto, como siemrpe he dicho cuando participaba en algún “debate”.

    ¿por qué pongo comillas rodeando la palabra debate?Porque en un debate se hace una discusión lógica, convincente, que cree riqueza a ambas partes. Y eso es imposible, aunque en este blog lo hacen imposible patrioteras como fanfatal, que me da que ni pincha ni corta, ni sabe donde coño vive. Esto no es el fabuloso mundo orwelliano donde “todos han de hacer lo que hagan todos”. Es decir, muestra un poco de inteligencia saliendo de tópicos baratos, sal ya del culo del toro de osborne, o usa con tus ojos, para mirar el mundo, los 16’7 millones de colores existentes, en vez de los tristes dos de tu bandera. Piensa un poco antes de tachar el catalán con adjetivos tan poco nobles, y recapacita a ver si, entonces, puedes tu quejarte de que esos “sucios catalanes”(como diría todo planoencefálico que no usa la cabeza sino la tele para pensar, sí, es ironía) ataquen tu idioma, que, por cierto, no es idioma porque ahora la “hablen millones de personas el mundGUAGUAGUAGAUGAUAGUAGA”(perdón, me asquean los tópicos, no puedo enumerarlos como los españoles de bien). a lo que iba, no es idioma porque sea “el segundo en U.S.A.”, sino porque un día una gente comenzó a usarlo, y su uso no se perdió, ni se vió amenazado por ningún pueblo demasiado vanidoso e imperialista, ni ha tenio que defenderse con uñas y dientes en la tierra donde nació…es más, porque ningún jodido inglés ha venido a España a decirnos cómo cojones debemos hablar cuando estemos delante de ellos. Porque ningún gallego que tiene que ir a currar a Madrid se queja de que le hagan hablar español(fuera ya de oficialidades, o no, porque como muy bien dice Rosa, el catalan, el gallego, el asturiano, el vasco y todas las lenguas que quieras enumerar, forman parte de España, te guste o no, y sino te gusta, te recomiendo te encierres en casa y veas el No*Do, porque será lo más cercano a tu concepto de España que vas a ver.

    Y, oye, déjate de tópicos, responde habilmente con lógicos, no te escudes en quea los polacos no critico, es que en mi discurso ya he metido, que defiendo la libertad antes que la bandera, o que cualquier estúpido mito, y no soy tan tan cretino, de ir quejándome de que los moros quieren imponerme creencias, cuando estoy yo en Barna intentandoles imponer una forma de hablar, diferente (aunque de la mano) a la que se usa en el resto de España. Si no te gusta, te jodes, y te ves el No*Do, pero no me digas que no es de locos, la verborrea marinera y armada, impregnada con un himno sin letra, de un país que heredó una lacra: la ignorancia y la autarquía mental, en vez de recoger todas sus gracias: riqueza, libertad y diversidad. Y que se jodan los que quieren imponerme a mí una lengua, soy castellano hablante y enfermaría sobremanera, si algún listillo impusiera como hablar en mi casa, pero soy lo suficientemente honesto, como para aprender una lengua nueva, si donde voy solo ella se habla. Y con las multas vete a casa, o demuestrame esa farsa, que un poco te digo rimando, que la intransigencia me produce arcadas. Abre la mente, abre la boca, te meto libertad y las escupes con tu bandera. Si no quieres democracia vete a China o a Colombia, dos colores diferentes para ocultar el poder, ¿unos buenos y otros malos?, no, es que no lo sabes ver muy bien: poder coloreado para oprimir a la gente, y la gente como tú les ayuda en su labor, gracias, a ti a sin blanca, por buscar una España podrida donde todos piensen como Paco. No quiero una España de carrillo, para cuellos que morder no pongo el mío, pero tampoco voy a tolerar que vengan los cuatro azulitos y me impongan como amar a España, cabrones, mierda, joder, vomitonas en mi alcoba cuando pienso en tu España, más se convierten en orgasmos cuando veo la España crisol de culturas, y crisol no es “roto”, sino “unido”, y no es un unido fascista, es un unido libre, quién quiera que se apunte, quién no que lo dispute, pero no con armas viciosas como los mitos sobre los pueblos, sino que un buen lápiz que le haga sombra a mi prosa.

  188. Ahí tenemos el claro ejemplo de un nazi intolerante a los que nos gasearía a todos los que no piensan como él.y que por supuesto no tolera que sus convecinos hablen el idioma de su tierra, que está de acuerdo con dar escarmientos a los que se salgan de lo que él considera que es lo correcto, cambiémos a los castellanohablantes catalanes por los judios en Alemania, a las camisas pardas y juventudes hitlerianas, por los maulets y las juventudes de ERC, y hagan el paralelismo.

    Pobres catalanes que tienen que vivir con esta gente, y que tienen que sufrir sus amenazas de muerte,,apaleamientos y sus señalamientos.

    Se han quedado en la tribu, la cabra y la boina naZionalista.

    Una verdadera pena, lo que fue Cataluña y lo que es ahora.

  189. Perdone señorita FAnfatal, pero no he dicho que fuera a gasear a nadie. Teneis manía los intolerantes de tachar de intolerantes a los demás. Además de decirte que no soy catalán, sino castellano, te he dihco que vivas y dejas vivir. Que abras los ojos a colores más variados que los de tu depravada bandera, y te lo digo a tí, que tienes tres barras rojigualdas, y s elo digo a los catalanes intolerantes, que tienen unas cuantas barras más en su banderita. No des la vuelta al asunto, cualquier mente inteligente vería más cerca el gas en tus armas que en las mías. yo no voy por ahi gritandole a la gente el idioma en el que debe de hablar, ni soy el que le da miedo que la gente eliga la opción que a uno menos les gusta, porque es le puto pan de cada día. Si fuera un “gaseador” quizá ya hubieras oído hablar de mí. Pero el odio no merece la muerte de nadie, por mucho que tenga una mente tan retorcida e inutil como para dar la vuelta a los asuntos y tachar a Gandhi de “asesino”(si, m gusta la paz y la no-violencia) . Depravado, ¿no sabes hablar?¿no sabes ser libre?¿Pensar por tí mismo?Entonces no entres en debate, si no quieres debatir. Si quieres una sarta de tópicos, de uno u otro lado, vete a la web de ERc, Ciu, PSOE, PP….y fía tu vida a un desconocido que solo busca el poder, yo mientras buscaré mi camino sin poner cadenas a nadie, ni para “atar ni para hacerme ver”. Respeto, lo que pasa que tu mente cuadriculada no te deja ver que no osy ni naZionalista ni rojo. Es como cuando orgullosos marinos vascos, con un genovés al mando, siguió las instrucciones de una castellana y su marido aragonés, para ir a buscar rutas alternativas para ir a la India, y se encontraron (que no descubrieron nada, sino que simplemente se toparon con ello) con un continente desconocido, que decidieron “evangelizar y castellanizar”(o encadenar y matar si te resistías). ¿anda!que no sabías que nuestra lengua fué inculcada con sangre en la mayoría de los territorios de los “400 millones”?Uf, pues si que sabemos poco. Yo amo el castellano, pero no soy tan cateto como para compararla con cualquier otra lengua, necio, porque sé que, por historia, tengo las de perder. Dónde estaría estas palabras sino fueran por las armas de mis antepasados. El resultado es bonito, un idioma rico, pero no fardes, listo, sino quieres que te digan lo mismo que tú dices. Vive y dejar vivir, yo no qurieo gasearte, quiero que sigas mostrando tu opinión, en la lengua que quieras. PArece que eres tu el que no va a escuchar a gente porque habla “un idioma de catetos”(rememoro tus palabras, adalid del civismo, quejica del insulto, victima de la barbarie catalanista…¿?”Lo vuestro es garrulismo y catetismo a más no poder, no se puede imponer un dialecto que hablan cuatro catetas a un idioma como el Español que hablan más de 4oo millones de personas en el mundo.”. Me encanta tu “no-anticatalanismo”, tus continuas referencias a los de los rótulos (que es, claramente, sucia mentira), tus comparaciones de los catalanes y los nazis (cuando fué el cañí general españolista que le dió la mano a Hitler, y no Tarradellas), y tu ceguera completa al gritar copntra la imposición de un idioma mientras agitas la imposición de otra lengua a unas personas que, te guste o no, puede que usen el catalan porque es su idioma cotidiano, no porque crean en ninguna puta nació. Tu hipocresía deja tu discurso a la altura de cualquier político, es decir, hipocresía, tópicos, noticias tergiversadas…no eres más que una ovejita. Al menos yo me cago en Stalin sin tener que meter a los RRCC. Y no temo cagarme en Franco mientras escupo en cArrillo. Pero muchos españolitos no saben hacer eso, y es el gran problema, quizá os falte parte del cerebro. Pero no será porque yo te haya gaseado…eso ya lo haces tú mismo día a día con tu mezquino pensamiento.

  190. Por cierto, dime tú en qué se diferencia tu discurso del de cualquier catalanista exacerbado que odia, igual que tú, su “enemigo idioma”. Cogo tus palabras y las cambio y las doy una vueltecilla, a ver si te das cuenta lo burraco que eres(en parentesis te pongo mis apreciaciones, que quizá coincidan con tus mied…pensamientos):

    “Ahí tenemos el claro ejemplo de un nazi intolerante a los que nos gasearía a todos los que no piensan como él(si no es España unida, eres un rojo de mierda pijiprogre que quiere el fin de nuestra orgullosa nación).y que por supuesto no tolera que sus convecinos hablen el idioma de su tierra(el catalán, que usan en casas y en comercios, desde quizá hace más años que los castellanos el castellano), que está de acuerdo con dar escarmientos a los que se salgan de lo que él considera que es lo correcto(es decir, una, grande y libre), cambiémos a los catalanohablantes españoles por los judios en Alemania, a las camisas pardas y juventudes hitlerianas, por las camisas azules y la impune Falange y hagan el paralelismo.

    Pobres españoles de Cataluña que tienen que vivir con esta gente(en muchos rincones de españa), y que tienen que sufrir sus amenazas de muerte,apaleamientos y sus señalamientos.(esto es exagerao…te has visto hace poco el pianista o que?)

    Se han quedado en la tribu, la cabra y la boina naZionalista.(de esto no cambio nada, solo apunto que la cabra es la de la Legión).

    Una verdadera pena, lo que fue España, crisol de culturas, y lo que es ahora.”

    Ala, ya puedes acostarte sabiendo una cosa más: eres un naZionalista catalan invertido, es decir, lo contrario, es decir, un naZionalista español…Qué pena, eres tu propio enemigo, pero adoctrinado por diferentes medios y ambientes…eres el producto de la depravación patriótica de uno de los lados en contienda. Tú mismo.

  191. Vaya tochos infumables que escribes, no hay quien se lea tanto rollo. y no soy señorita,soy señor, thanks.

    No existe el nacionalismo español,igual que no existe el nacionalismo Británico, ni el francés ni el norteamericano. pero bueno, sigue diciendo chorradas.

    ¿dónde digo yo que no se pueda hablar catalán?¿dónde digo yo que la bandera española, bla bla bla y bla?

    Ponerme de parte de la gente que en cataluña es multada, perseguida, apaleada,amenazada de muerte, invitada a abandonar su tierra, etc. me convierte en un intolerante? anda majete, tómate una tilita y deja de decir chorradas. Dices que eres castellano,¿ Y? pues anda que no hay castellanos, gallegos(el impresentable de Rubianes es gallego) que se ponen de parte de los carceleros. anda que no hubo franceses que se pusieron de parte del invasor alemán!

    Eres un vulgar aprendiz de Rubianes, que insulta al resto por pedir lo que tenemos los españoles en el resto de España. Tú sí que estás adoctrinado pero en el odio a la gente que no es como tú, gracias a Dios.

    Vamos que Rosa Díez, Albert Boadella, Loquilo y los Trogloditas, la gente de ciutadans, PP y Upyd, son unos peligrosisimos patriotas. (ya te he dicho que no existen los nacionalistas españoles) que abogan porque cada uno se exprese en el idioma que quiera, y que se cumpla la ley en la que los catalanes, gallegos o vascos puedan ser escolarizados en su idioma o rotular sus negocios como les dé la real gana.

    Qué pena que haya gente como tú, que tache a la gente de lo que tú eres. Porque si de mi, que no soy especialmente patriota, dices lo que dices, de alguien que lleve en su blog la bandera de su país, no puedo imaginar las memeces que podrías decir de él.

    Miedo da de pensarlo.

  192. Ah! y felicidades al Real Madrid,por ganar una vez más la liga supongo que ser del Real Madrid, me convierte en un peligroso patriota madrileño y español y Raúl con la bandera española a la espalda, ya ni te cuento.

    ¡Hala a rabiar un poquito!


  193. Boigandreau:

    Qué caos mental y cuanto humo habita tu cerebro, Boigan.

    Ni Fan, ni yo queremos la eliminación del cat: Sólo queremos LIBERTAD para elegir e igualdad para las dos lenguas pues las dos son oficiales. Eso no es ser fascista, ni siquiera nacionalista excluyente, es simplemente querer lo mismo para todos.

    No sé de qué extrañas pajas mentales sacáis o Putoloco que Fan y yo odiamos a Catalunlla o al catalán. Sois cansinos y -perdona que te lo diga, pero Fan tiene razón- aburridos.

    ¡Qué cruz con estos castellanos anti españoles!

    Fan Fatal:

    Siemto decirte que a mí el Real Madrid me la reflanfifla. Me alegraría mucho si el Getafe, el Villarreal o el Numancia ganaran algo, pero en general, Alonso, Nadal, Gasol y cía me son más que antipáticos. Que la gente -como 200 mil personas- hayan estado hasta las tantas celebrando que unos multimillonarios pudieran justificar sus opíparos sueldos me parece de deprimise hasta el fin, sobre todo, si sabemos la que está cayendo en nuestro país y vemos cómo la gente pasa un kilo de su futuro y de su presente.

    El deporte es el verdadero opio del pueblo, ya no lo es la religión.

    Únicamente me gusta el fútbol cuando juega la selección española, pero lo paso tan fatal que prefiero no ver ningún partido. Después me llevo el berrinche o la alegría según sea el resultado, y al final, como hasta ahora, siempre berrinche, pero me doy rabia a mí mismo por ser tan imbécil, tan estúpido y tan borrego. Tengo que decir a mi favor que cada día que pasa me importa menos y espero que en el futuro pase del todo. En fin, todavía tengo que aprender…

    ¿Has visitado la página de Boigan?: http://pipasdecoco.wordpress.com Tiene cosas interesantes, aunque es progre sin remisión…

    Por cierto, ya es la segunda o tercera vez que te cambian el sexo…jajajajajajjajajaja A ver si nos vas a seguir los pasos de la Nova… Sería de escándalo. Imagínate: NOVA FATAL, ¡Qué nombre!

  194. Vaya, ahora Fan no ha llamado “idioma de catetos” al catalán, y no lleva varios comentarios dando la barrila con eliminarlo y estudiar castellano por güebos…vaya diálogo de besugos tio, ¿no leeis lo que digo? No digo que el que tenga la bandera sea peligroso, sino depravado, y no digo que sean peligrosísimos, solo que dejen de querer imponer un idioma que ya se habla en Cataluña, en detrimento de otro que, también se habla, pero de forma más general, en esa zona de España. Si Libertad es elegir..¿por qué no dejais elegir y dejais que querer imponer (como hacen los socialistas..) lo que te “parece mejor”. Si amas la libertad, deja a la gente que eliga, TIO, y no vengas con discursitos baratos. Asi que ahora…¿no existe nacionalismo británico, ni francés, ni..norteamerciano???jajaj…joder…pues dime tú pa que estan sus banderas, sus himnos, su marcialidad, su fiesta NACIONAL….en fin, después de esto…mejor callarme la boca la verdad, porque solo buscaba entraos en la cabeza que los catalanes son los que deben o no hablar catalan, y que si vas a Catalauña, donde se habla normalmente en catalán, y te gusta el respeta y la libertad (como sugeris con ese victimismo tan barato como antiguo), pues dejad que hablen lo que quieran!!Y si vas a llí, y te hablan en catalán, primero piensa que es tb su lengua, joder, que es lo que no os cabe, ni nació ni paisos, es su cultura, TIO, ¿qué parte no entiendes?Si el tipo te habla en catalñan aun sabiendo que eres castellano, pues mandale a la mierda, pero no generalizes, generalife de pacotilla. Tu no sabes ni qué es la libertad, porque la libertad, que yo sepa, no se impone, se conquista. Asi que ya sabes, prueba con la enciclopedia británica, y empieza a definir en tu cabeza la palabra LIBERTAD, que creo que no es ni imposición del idioma de los “400 millones”,(al que, repito, amo, es mi lengua, me parece estudpenda, rica…pero mi tolerancia y mi mente abierta m permite aceptar lo que tu cavernicola mente no acepta: que haya otros idiomas en España y que, esos idiomas, convierten a España en un país mas variado. Que lo usan politicamente?Si, pero tu tb lo haces con el español, asi que retírate la viga del ojo y deja de hacer pajas a los demás. Dixit. A ver como das la vuelta a esto, porque ni he hablado del PP, ni de Boadella, ni de ninguna de las tonterías con las que replicas. Y, tio, siento la extensión de mis post….vo que no llegas al nivel de leer 5minutos seguidos, pero ni comprender, porque la vuelta que di a tu post deja entrever lo que digo: yo no apoyo ningun NAZIonalismo, tu atacas uno apoyando a otro, el nazi eres tu, que quieres imponer tu “ariedad española” a quién no piensa como tu. Yo, en cambio, prefiero habalr y poner “tochos” de texto, en vez de gritar los 4 vientos la victima que soy en una tierra donde ni siquiera vivo. Si fuera a vivir a barna, aprendería catalan, como lengua española que es, como lengua materna que es en esa zona, y como lengua que se usa normalemnte allí. Arrogancia y necedad sería querer que m hablen en mi idioma POR COJONES, es de niñatos, asi que me da que mucho señor no eres, aun no has madurado. ADios, diálogo de besugos non.

  195. Boigandreau:

    Te repito: Que hablen lo que les dé la gana, pero que el bilingûismo se vea en todos los ámbitos de la vida oficial. Los dos idiomas en la enseñanza, la prensa pública, las radios, las televisiones, los carteles, los rótulos, los folletos. etc, etc. etc. Y ya está.

    Que la gente en la vida privada hable lo que le venga en gana, pero las instituciones que sean bilingües, como la sociedad. Y eso que el catalán es la lengua normal en Catalunlla, no me hagas reír. Si el catalán puro lo habla poca gente, lo entiende la mayoría, lo escribe bien los menos, pero la lengua que verdaderamente hablan los cat ahora es una mezcla pobre y analfabeta de los dos idiomas. Un asco hablar con los catalanes, sobre todo con los jóvenes. Son de una incultura vastísima y bastísima… Y cuando te sueltan eso de la cultura catalana, ya es que te dan ganas de vomitar porque están absolutamente convencidos de que son algo especial. ¡Pofavó! si los andaluces o los castellanos se pusieran a fardar de lo que han dado al mundo, los catalanes se morirían de vergüenza por su insignificancia.

    Queremos LIBERTAD ¿Te entra eso en tu maravillosa cabeza, sí o no?

  196. Este chico, o lee lo que quiere, o es que no entiende el castellano-español, porque si no no diría tanta memez que dice que he dicho.

    Alma de Dios, ¿dónde he dicho yo que hay que eliminar el catalán y que hay que prohibir que lo hable la gente? ¿Eso mismo lo ha dicho Albert Boadella, que en su vida diaria usa el catalán y al que una organización nazionalista ha pedido que gaseen? Esa memez de prohibir el catalán lo lleva en su programa Ciutadans? porque tú entiendes lo que quieres oír.

    A ver si te queda claro, yo he dicho que no es de recibo que no se pueda escolarizar la gente que quiera en español, si hay colegios que imparten las clases en catalán me la suda, mientras los que quieran en español también tengan ese derecho.

    He dicho que no hay derecho a que en tu propio negocio privado, se meta la Generalidad o el ayuntamiento a multarte porque rotules en español, porque te sale del higo y porque es tu idioma.

    He dicho que no hay derecho a que te apaleen o te amenacen de muerte y te tengas que ir de tu pueblo o ciudad catalana por las amenazas de naZionalistas catalanes,entre ellos gente como Sergi Arola, Sabino Méndez o Loquillo y como han tenido que hacer muchos catalanes que les es asfixiante tener que vivir en una atmosfera así.

    Si a ti te parece lógico todo esto…..

    Pero no pongas en mi boca cosas que no he dicho de prohibir el catalán o de que me hablan en catalán en la ciudad, y de Franco (el tema comodín) y de leches.

    Y por cierto, lo de los británicos y su Union Jack, lo de los americanos y sus barras y estrellas… no es nacionalismo, es patriotismo, que no te enteras.

    Debe ser que Madonna con sus camisetas americanas o las Spice Girls con su bandera británica en las camisetas, es porque son nacionalistas, anda que…..

  197. Puede que no estemos al final tan lejos. Es que no me gusta comentar algo y que le saquen mil significados. No soy naZionalista…ahora..me vas a tener que dar la explicación de la diferencia entre unas personas que aman a una bandera….y otras personas que aman una bandera…nación…patria…la diferencia es bastante difusa…a mí ambas dos me aprecen depravadas (siguiendo con Oscar Wilde).

    Ahroa, fan fatal, ahora, es cuando has acudido a mostrar tus puntos de vista sin apoyarte en atacar los contrarios, que es lo que quita mucha fuerza a tu discurso. No te puedes quejar de vicio y estar viciado. Es a lo que voy. Que yo estoyu porque cada uno hable lo que le venga en gana, que nadie obligue a nadie a adquirir una cultura que no siente como suya. Pero te lo digo para tres barras, y te lo digo para las cinco barras.

    Tú no has hablado de prohibir el catalán, ahora que releo quizá lo de “eliminarlo” no era propio, pero si hablas de un idioma de “catetos”, de estudiar en castellano y de que se trata de una mezcolanza entre dos idiomas…más que pobre me parece bastante rico. Es a lo que voy, ni vosotros ni los naZionalistas veis la riqueza de tener dos idiomas propios, compartidos, distintos…¿sabes lo que daría yo por saber dos idiomas, y que los dos se hablaran en mi tierra?Primero, no impondría mi segunda lengua a nadie, pero ni dejaría que cuatro pibes que viven a tomar por el culo de mi tierra, me digan cómo tengo que hablar o fomentar mi idioma. Igual que tú no le permitirías a un ingles meterse en tu política lingüística alegando que su idioma lo habla “el triple de la gente de la tierra que el tuyo”.

    La Generalidad o el ayuntamiento no deben meterse en tus asuntos. Ahí estamos de acuerdo. Pero sigo en ims trece y digo que nadie tiene derecho a decirte como hablar.

    Leía antes a Sinblan que se quejaba de que en CAtaluña no hay democracia…que los medios no hablan del problema lingüístico, que se intenta imponer el catalán sobre el castellano….sinceramente, el Sábado hablé con dos catalanes, que no m hablaron en catalán, que hablaban bien el castellano, con los que comulgué en su idea de Libertad. Vuestra libertad es imposición, la nuestra es respeto. Es de lo que no os dais cuenta: los catalanistas dicen: “En mi tierra es oficial el Catalán, y no podemos permitir que otra lengua (por cierto, también oficial) nos coma”. Vosotros decís: “En mi tierra es oficial el castellano, y no podemos permitir que otra lengua (que, por cierto, es oficial) nos coma…”. El problema es que algunos de vosotros lo decís desde Murcia, donde el catalán no se usa, y ellos lo dicen desde la tierra donde se habla su lengua. Sois naZis!Como vosotros decís. Sois putos patrioteros como ellos!!Y os la suda la Libertad mientars se escriba así, Libertad, en vez de Llibertat, que es como quieren que se escriba ellos. Yo digo, usad la que querais, que apra algo son parte de nuestra cultura, pero respeta al que no lo sepa, no te quieras imponer y deja a cada que haga lo suyo….Si esto, fan fatal, es querer gasear…quizá no sea yo el que dice “tanta memez” o el que no entiende castellano-español…

    ¿Votas a Ciudatans?Vaya…yo los voté..pero pensaba que eran menos radicales que los radicales contra los que luchaba…una pena…al final será mejor la libertad plena de la anarquía que la delegación del poder en tanta mente insana, de tantos colores, pero que lo unico que buscan es aferrarse al poder..mientras tanto tú y yo…debatiendo en un blog patriotero naZionalista español, cuyo autor seguramente no tenga ni puta idea que no es la tierra ni de socialismos impositores, ni de socialdemocracia derechona impositor…sino la tierra de la libertad, liberalismo y libertarismo. Respeta, y no impongas. Y deja de usar tópicos, que eso lo sabría hacer un mono con unos días de entrenamiento, leñes.

  198. Es típico de la progresía defender ahora a los naZionalismos excluyentes y aldeanos que no vé más allá de sus fronteras.
    El naZionalismo se cura viajando. Cataluña y Barcelona se han quedado muy atrás, entiendo perfectamente que la gente siga huyendo de alli.

    Asi que llevar una bandera norteamericana en una camiseta, es ser nazionalista americano? jo jo jo, no lo había oído en mi vida. Ya te he dicho que una cosa es ser patriota(amar tu país,no decir que tu aldea con 4 cabras incluidas, es un país)y nazionalista otra.

    joder, ¡en que se ha quedado los progres! defendiendo a los carceleros y apaleadores de personas que quieren estudiar, expresarse en el idioma de su país, y no en la de la aldea con sus 4 cabras.

  199. Venga tio, vete con tu demagogia a las cuevas de altasmiras, porque me da que no te cogo ni una. Ahora resulta que soy progre y defiendo a los naZionalistas…capullo: estudia historia, que parece que la tienes algo dejada, y verás que hubo una época donde los nacionalismos románticos ejercieron mucha fuerza para crear los estados modernos, y que, sin esos nacionalismos, muchos de los países que conocemos ahora estarían divididos en regiones, o etnias o vete tú a saber qué.

    Si patria no es nación, reitero que me expliques la diferencia. Y…bueno, lo de estar de al lado de “carceleros y apaleadores de personas” es la frase mas ruín que he oído nunca, piérdete en tus veleidades, creerás que eres superguay, con tu pulserita rojigualda y tu amor a la patria sobre todas las cosas….pero yo paso de naciones y patrias, asi que no me involucres en tus guerras, depravado. Ahroa resulta que hay diferencias entre nacionalismo y patriotismo solo por la sola existencia de un Estado. ¿Ves como no tienes ni idea?. Piérdete en tus mares castellanos excluyentes, con tus cabras de la legión…pero permite vivir a la gente en paz, y buscate el siginificado de Libertad. Ale, Fansuperfatal, sigue gritando Arriba España con toda libertad. Ortos amaremos España sin aplastar a nadie, y, con suerte, cambiándola a mejor.

  200. Sinblanca, enhorabuena, has creado el primer blog para sordos patrioteros que no buscan usar la mente sino la imposición. Enhorabuena, has conseguido juntar a todos los Homo Sapiens Patrioteris y a todos los Homo Sapiens Nacionalis para que se muerdan entre ellos sin abrir los ojos ante nada, pero ni usar el cerebro. Luego llega gente como yo que critica a ambos bandos y le tachan de ambos bandos. DAis asco, de verdad, de verdad, me saca de mis casillas el pueblerismo de fanfatal, su aldeano comprotamiento, más parece una churra que una persona. Y encima no se da cuenta, y encima niega!!!Que haya nacionalismos en los estados modernos…¿de qué te crees que viven?¿qué te crees que se consigue con alonso, con La Roja, con NAdal….ganais vosotros su pasta?NO, pero claro, si un español gana algo..ganamos todos…es el pensamiento más futil que he oido nunca, relajaos y vivir vuestra pura vida, y dejaos de vivir por una bandera y un himno…sin letra XD. Yo no necesito simbolos para amar a mi tierra, ni necesito aplastar a nadie para sentirme más español, ni mucho menos necesito aprenderme topicos askerosos para estar orgulloso. Vivo y me relaciono. Además, no sé de donde sacais lo de la Barna que “se ha quedado muy atrás”…lo mismo es que os faltan personas grises corriendo detrás de gente que gritaba Libertad y Llibertat, cuando esa diferencia no creaba controversia sino riqueza.

    Ala, perdeos en vuestras convicciones siglodiecinuevistas, y, recordad, que España siempre fué decadente e inhumana, salvo cuando se dejó a la gente vivir en libertad. Dejadme de acusar de defender a putos naZionalistas cuando os estoy atacando a putos patrioteros.

    Patriotismo: Amor a la patria.
    Nacionalismo: Apego de los naturales de una nación a ella y a cuanto le pertenece.

    Ahora, fanfatal, vete a dar lecciones de Lengua Castellana a esos malvados catalanes…aunque, como sea por tí, me da que van a quedar algo planoencefálicos.

    buenas noches

  201. Boigandreau:

    Majo, me encantaría que vivieras en el extranjero por una temporada larga como lo he hecho yo para que te dieras cuenta de lo español que eres.

    No tengo ni idea de la edad que tienes, pero tus opiniones parecen sacadas de las conversaciones de estudiantes de secundaria que se ponen a filosofar sobre el mundo después de una noche de botellón.

    También me gustaría que optaras a un puesto de trabajo en cualquiera de las CCAA con otra lengua a parte de la de todos y se lo dieran a otra persona porque tú no puedes hablar la de “allí”, aunque estés incluso más capacitado para el puesto.

    ¿ No te das cuenta que todas esa gilipolleces sobre la protección del idioma no son sino para que ellos, los naZionalistas, tengan siempre más oportunidades que los no naZionalistas y los que provengan de otra parte de España? ¿ Cómo puedes ser tan tonto? ¿ Qué naZionalista se preocupa por tus intereses? ¿ Por qué te empeñas en defenderles?

    Mi bitácora, que no blog -yo no uso anglicismos-, es patriota española. Y a mucha honra.

    Yo sí soy español. Tú lo pareces ser de boquilla, pero res de res més.

    Fan Fatal es un patriota. Tal vez no debiera decir que el catalán es un dialecto de aldea, pero es que eso es lo que es. Los hablantes nativos de cat en Catalunlla no pasan de los tres millones. Es una lengua que no sirve para nada sino para llenar los bolsillos de los naZionalistas y de los que reciben las subvenciones que pagamos todos los españoles para producciones culturales que nadie lee y que nadie ve. Yo hablo catalán y lo escribo. ¿ Y de qué me ha servido en los diferentes países donde he estado? De res. Se me interfiere con el italiano y con el portugués en mi cerebrito. También puedo entender la TV3 que es una fuente impagable de imbecilidad y de odio hacia España y hacia todo lo español.

    Antes te hice una recomendación sobre “vivir en el extranjero”. Tengo otra -y que sirva también para ti, Fan Fatal-. ¿ Por qué no aprendéis catalán, no a hablarlo porque sería una pérdida de tiempo, pero sí a entenderlo? Así podrías atacarles tú, Fan Fatal, que entonces entenderías todas sus sandeces y tú, Boigan, te darías cuenta del odio que destilan los naZionalistas. Estoy seguro, Boigan, que entonces cambiarías de opinión y tu corazoncito español, que lo tienes allá en lo muy hondo, te empezaría a sangrar. Temps al temps, nen.

  202. La verdad es que le has contestado muy bien, Sinblanca, es verdad que su vocabulario está sacado de un botellón y yo también le recomendaría que viajase un poquito, ya que la imbecilidad y el naZionalismo se cura viajando. Sinblanca entiendo catalán ya que viví una larga temporada en Ibiza y sé lo que es el naZionalismo aldeano del que este sujeto no tiene ni puta idea de lo que habla.

    También me hace mucha gracia que el sujeto éste, por llamarlo de algún modo, me endose etiquetas sin conocerme, como lo de correr con los grises o llevar pulseritas de la bandera de España, mira, pues no llevo ni pulseritas de la bandera de España(no me importa quien lo lleve y me parece estupendo llevar la bandera de tu país, why not?) pero sigues errando, ya te he dicho antes que no soy especialmente patriota(que no naZionalista) y las únicas banderas que llevo en alguna camiseta que otra es la de las barras y estrellas y la union Jack británica. Será que soy un “nazionalista” norteamericano y británico y en vez de cabra llevo caballo y bulldog? (sic)

    ¿Y éste se cree que sabe de historia? Gracias por aclararme que las Spice Girls y Bruce Springteen son naZionalistas en vez de patriotas que aman a su país.
    Y se sienten orgullosos de ser americanos o británicos. Anda que…..

    frases dichas celebridades sobre el Nazionalismo que el sujeto de arriba confunde con patriotismo:

    Pepe Ribas, fundador de la revista Ajoblanco.
    “La deriva del nacionalismo emancipador decimonónico hacia la intolerancia y la opresión estaba seguramente inscrita desde el comienzo en la ambigüedad política de su proyecto.”

    Uy! Pepe no digas eso y más siendo catalán que te van a acusar de anticatalán y nacionalista español(sic)

    Patriotismo es cuando el amor por tu propio pueblo es lo primero; nacionalismo, cuando el odio por los demás pueblos es lo primero.”
    Charles de Gaulle

    Por mi vida han galopado todos los corceles amarillentos del Apocalipsis, la revolución y el hambre, la inflación y el terror, las epidemias y la emigración; he visto nacer y expandirse ante mis propios ojos las grandes ideologías de masas: el fascismo en Italia, el nacionalsocialismo en Alemania, el bolchevismo en Rusia y, sobre todo, la peor de todas las pestes: el nacionalismo, que envenena la flor de nuestra cultura europea”.
    Stefan Zweig, escritor austriaco.

    “Yo creo que el nacionalismo vasco, como casi todos los nacionalismos, son expresiones de un miedo, que casi siempre es el miedo a desaparecer”.
    Imanol Zubero, miembro de Gesto por la Paz.

    A ver si se te pega algo de sabiduría, porque me parece que tanto botellón te está dejando sin una neurona sana.

  203. No quería recurrir al insulto, pero se me acaba de joder una web en la que llevo trabajando sin parar durante tres semanas, y me tengo que cagar en alguien. sois los elegidos….¿sois jilipollas o que?que no soy naZionalista, ostia, que no defiendo a los catalanes, joder, pero no por ello tengo que defender a energúmenos como vosotros. No necesito citas ni tópicos de otros para formarme una idea d elo que quiero o no quiero. Fanfatl, el botellon le tienes tu en la cabeza. Habrás vivido mucho pero seguir sin ver que no hay diferencia entre patria o nación, es más de catetos que las amapolas, se nota que te gustan las Spice. Banderas, trapos viejos cargados de odio contra el enemigo, si quereis usarlas hacedlo, pero no obligueis a hacerlo a nadie. No soy naZionalista, pero tampoco soy un niñato de bachillerato, soy aprendiz de poeta, quizá pudiera alardear de volcabulario, pero no me va. Seguramente hayas tenido grandes conversaciones con mucha gente, pero poco has aprendido, por mucho que hayas visto, poco se te ve listo. Puede ocurrir que me confundiera limitandote a una pulserita, pero al menos lo reconozco, no sigo diciendo paridas tópicas ilógicas que no me aportan nada.

    No tengo el día, ni para luchar contra patrioteros ni contra naZis españoles ni catalanes…pudriros en vuestra lucha, hundíos bajo vuestro odio…que yo me bajo.

    Con respecto al lenguaje del botellon, se nota que no teneis ni puta idea. Vivis de tópicos, que pena. Yo, al menos en mis botellones, suelo hablar DE TODO, pero, por suerte, la gente que conozco patriota, no es tan lerda como vosotros, sabe ver puntos de vista, sbe no ver solo el balnco y el negro, y sabe le valor de la cultura..algo que, parece, os falta.

    Pudriros en vuestras convicciones, yo m pudriré en las mías, pero espero no tenerme que cruzar más en vcuestros caminos.

    Sinblanca, enhorabuena, tu estúpido blog con tus estúpidos artículos y tus vanalidades egocéntricas han terminado de cansarme.

    Fan FAtal, escúchate más los ochenta, lo mismo aprendes algo sobre la convivencia y la diversidad. Ah, y la mente puedes probar a abrirla. Listillo.

    Lamento que esto acabe así, de veras, pero sois muy mezquinos, demasiado poco honestos, y, con ayuda del día que llevo, solo tengo una sensacion de asco hacia vosotros. Asco, que no violencia o “apaleamientos”, asco, respeto, pero asco, hablado, no voy a tapar la boca a nadie como sí os gustaría a vosotros con los que no hablan cervantino, pero yo tengo más miras y no voy a dejar que me embauqueis con chorradas naZispatrioteras. Ale, a mamarla.

  204. Boigandreau:


    Gracias. Me has hecho reír, majete.

    De acuerdo, no eres naZionalista, pero tampoco criticas lo que Fan Fatal y yo tanto criticamos, como es la IMPOSICIóN del catalán y las tropelías de los naZionalistas.

    Aquí no se te ha visto una sola palabra contra los naZionalistas… entonces el que calla, otorga, ¿no crees?

    Bueno, sí. Dices que no quieres la imposición de lengua. Pero, sin embargo, no veo que escribas una entrada en tu bitácora condenándola… En fin, mucho de boquilla, pero na’ de na’.

    Me ha encantado que me mandes a mamarla. Esa es una actividad que me chifla. Te mandaría a Catalunlla a que te dieran por culo, pero como no te gusta, no quiero ser menos galante que tú. Sin embargo, espero que te pasees por allí. A ver qué es lo que haces cuando estén echando todos los días las pestes sobre los castellanos -como tú, nen-.

    Las citas de Fan Fatal son muy utiles. No las desprecies I aprèn català. Així comprendràs que en realitat ells t’odien i que volen no només destruir Espanya sinó destruir-te a tu..

    En fin, que no tenéis remedio. Ale, a follarla…

  205. Tch…..Ahora entiendo que aunque “entiendas”, no entiendes de nada más. Que malentendido entenderte como un entendido del buen gusto, y entender, finalmente, que no eres más que un simple entendido. Vamos, que me da que eres no vidente, un odiante de lo diferente, uno de la línea dura, porque llevo criticando imposiciones de ambos bandos desde que llegué a esta (muchas veces mezquina) bitácora. Tengo una amiga dominicana, que fué a vivir a Denia, que habla español, con toques de allí y de aquí, con vocabulario de Alacant y de Castilla, que no cree en ninguna de las dos naciones, pero que puede considerarse una chica rica en cultura, pues se ha movido en tres. Eso, es lo que yo busco, nadie le ha impuesto que hable una u otra, las habla y las respeta, sin decir a nadie cómo tiene que hablar. Tu criminalización exacerbada de TODO lo que huela a cultura catalana es lamentable, vanidosa y sumamente futil. Me encantaría saber hablar catalán, y no apoyaría a los pequeños depravados. Mientras esteis en guerra los dos bandos seguireis perdiendo. Yo no me incluyo, porque he conocido bastantes catalanes (como los últimos dle Viñarrock) y me pidieron medio permiso hasta para hablar entre ellos en catalán, que ERA LA LENGUA QUE USABAN EN CASA. Y no les escuché ni una vez decir la palabra “Països”…asi que tú me dirás. O me fío de la bitácora de un xenófobo con aires de humildad, o me fío de mi propia experiencia. Amigo, lo siento, creo que gano yo, asi que me fiaré de mi experiencia, y dejaré los caminos escabrosos del odio para que los difundas en tu bitácora. Yo no he puesto nada en la mía, es cierto, pero ahora no estoy yo muy político, y menos para ponerme de un lado u otro, cuando ambos apestan con sus tintes de reaccionarios, no son radicales, la radicalidad es respetar la democracia y no menospreciar otras culturas, sólo porque la mía, hace tiempo, fuera tierra de eterno sol. Hipócrita serás cuando las banderas sean quemadas y vosotros, los hijos de la depravación, os quedis huérfanos de mente. Ellos quieren acabar con España, España no soy yo, soy mucho más que un Estado melancólico de sus logros pasados y con un futuro agriamente perdido. Yo preguntaría quién quiere estar, y, los que quedeis en esa “Gran España”, o en esa “Gran Cataluña”, las disfrutais y os buscais el modo de arreglároslas, en un extraño régimen de pensamiento único. Los que queden en la España llana, de las relaciones, la solidaridad, la diversidad, la amistad y la libertad, sabremos, ten por seguro, lo felices que seremos sin tener que precocuparnos de la gente que sólo busca imponer e imponer. Y, seguramente, unos llevarán bandera, otros la quemarán, pero nadie se verá ofendido por quemar una tela o portarla, porque será eso, una simple y colorida tela. Y nuestra vida la dirigiremos nosotros, elegiremos lo que hacer, porque ni uno ni otro bando vendrá a aprovecharse: no les diremos “No pasarán”, les diremos “Pasamos de vosotros”.

  206. Boigandreau:

    Eres humo, guapo, humo.

    Tú estás por la solidaridad, diversidad, amistad, libertad… Ajjjjjjjjjjjjjjjjjjj Te faltó decir que estabas po´ la pa´ mundia´.

    Resula que has conocido a unos chicos majísimos que eran catalanes y que hasta te pidieron permiso para hablar catalán entre ellos. ¡Qué condescendientes! Si hubieras conocido a Miquel, http://blocdemiquelgil.blogspot.com/ , seguro que te habría restregado el catalán por la cara… ¿Y qué que hayas conocido a alguien decente? ¿Es que eso desface el entuerto del nuevo Estatuto o los de las políticas lingüísticas? Si tú me sacas una experiencia con gente catalana normal, yo te puedo sacar diez con gente catalana cerril… Esos mismos que te pedían permiso te dirían que te jodieras si quisieras educar a tus hijos en tu idioma, o se descojonarían vivos si pidieras igual trato para los castellanohablantes en Catalunlla.

    Boigan, gente como tú cava su propia tumba. Molt bé, molt bé, ells estimen molt els ximples útils.

  207. Me parto con el Boigandreau, y ¿dice que es poeta? ¡me meo!

    Creo que a este chico se le ha ido la olla completamente, y lo de mamarla… pues mira sí, me encanta mamarla, que parece que para ti es una práctica muy mala.

    Suelta unos tópicos y unas chorradas de campeonato y sigue sin saber lo que significa ser nacionalista, es tan burro que no sabe que no existe el nacionalismo español como tampoco existe el nacionalismo sueco o americano. pero bueno él es muy listo y se cree que lo sabe todo, juas juas porque conoció a unos catalanes en un botellón que eran muy majos, para mear y no echar gota.

    Parece ser que a este chico-botellón, le encanta a los catalanes que exigen ser escolarizados en español, se jodan por “intolerantes”, está encantado que a ciudadanos catalanes que rotulan sus comercios en su idioma español, les multen por “anticatalán” y por supuesto si apalean a gente que osa hablar en español, que reclama sus derechos en su propio país, para este sujeto que gusta tanto del botellón, le parece perfecto por que son unos “nacionalistas españoles que oprimen a la nación catalana”

    Pero él es muy tolerante, eh? los intolerantes son los apaleados, los perseguidos, los que tienen que exiliarse en otras comunidades autónomas(Sabino, Loquillo, Boadella, Sergi Arola, etc y etc…)porque son unos “fachas” que añoran que vuelva Franco, sobre todo Boadella que fue encarcelado por el anterior régimen, pero da igual son unos fachas intolerantes por pedir sus derechos civiles.

    ¡Pobre ignorante !

  208. pobrecitos pena me dan los perseguidos por las injusticias catalanas,¿¿pero como quereis que se exilien si a la mayoria no les conoce la cara ni su madre? ¿quereis martires? pues no los busqueis en Cataluña no nos gusta crear martires , una cosa es un estupido comentario como hacen muchos y otro es que el comentario os vaya de perlas para decir (inventar) burradas.

  209. Rosa: ¿Nadie conoce a Els Joglars? ¿nadie conoce a Loquillo?, nadie conoce a Sabino Méndez? ¿nadie conoce a Sergi Arola? hombre por Dios! encima no presumas de ignorancia, está visto que a ti te sacan del charnego de Rubianes , Buenafuente, o Sardá y ya no conoces al resto.

    Las injusticias catalanas de no permitir el español en España, querida. es como si se sacara el inglés de Inglaterra o como ya te dije antes el inglés de Irlanda primando el gaélico que no tiene ninguna salida en el mundo real, lo mismo que el catalán, sales de tu comunidad autónoma y te comes una mierda hablando catalán.

  210. Mi relación con Cataluña se centra sobre todo en Barcelona, y creo que es una ciudad mucho más cutre y tirada que Madrid, con una población mucho más alejada de mí misma. Es cierto que siempre hay una minoría de gente con la que te identificas, pero incluso esa minoría se siente allí desarraigada. Hay que reconocer que Barcelona ha ido adquiriendo una oferta cultural mucho más rica, que es más bonita y está todo más limpio, pero luego, cuando estoy allí y voy a los sitios, la gente no me divierte tanto. Es todo mucho más dogmático, las personas no se mezclan tanto, están más segregados».
    ALASKA declaraciones al diario El Mundo,

    Sinblanca: otra intolerante como Loquillo, o como tú y yo, es que….


  211. XD 🙂 Pobre…

  212. Por cierto, no me desprecies, por favor, deberías ir a algún botellón, la gente no es tan mala, no solo se bebe…creo que te falta socializarte…Lo que quiero que me aclares, ya que tu tienes tan bien la olla, cuándo he defendido yo las palizas, las multas en rótulos y toooooda esa retahíla de demagogia barata (y vieja..seguramente) con la que me acusas…vamos, te reto, enumera, amiguete..pero una cosa, enumera también cuando lo condeno. ¿Es muy fácil emitir un juicio verdad?Sobre todo con medio cerebro carcomido por telajes rojigualdos patriotas (que no nacionalistas, por cierto, según la Fanfatal, la nueva F de la R.A.E), Queda muy bien soltar una retahíla de mundanas acusaciones cuando hay tantos comentarios y la gente no suele leerse todo desde el principio, pero reto, por favor, a todo aquel que ame la verdad, que enumere cuándo y como, sin sacarlo de contexto he apoyado con mis palabras. No solo he conocido a catalanes en botellones, carquilla, pero te aseguro que los últimos, incluso si hubieran ido bien drogados, te superarían en mente abierta y reflexión…vaya palo llevar tanto tiempo en la tierra para sólo haber aprendido a imponer, victimizarse y llorar…una pena…a ver si disfrutamos algo de la vida…o bueno, antes puedes enumerarme lo que te comenté anteriormente, y, también, si tienes tiempo, y quieres cederlo a recapacitar y repasar en vez de aventurarte a acusaciones sacadas de Cine de Barrio, puedes también enumerar las veces que me he cagado en los nacionalistas y en los patrioteros, gente que, por suerte, es muy variada, y no todos son tan necios e ineptos como “los que aman la bandera por encima de su vida”. Vamos!FAn!!faN!!faN!!

  213. Por cierto, mirate en el espejo de Rosa..tú odias a Rubianes, ella a Boadella…¿por la bandera o por la lucha de cada uno frente a los que ellos, cada cual, consideran energúmenos planoencefálicos?Uf…a mí no creo que me odiara ninguno, porque no les iba a imponer nada, Rosa chocaría con uno…y el Señor FAn con otro…cara de la miiiiiiiiiiiiiiiiiiiiiiisma monedaaaaaaaaaaaaaaaaaay!!:)

  214. yo no odio a Boadella para mi al igual que Rubianes es un trepa, no chocaria con ninguno de los dos me son prescindibles. Por cierto en la feria de Abril del foro de Barcelona no habia un solo Rotulo en Catalan todos en Castellano, a parte de alguno en Brasileño y Arabe, no hubo ninguna multa y eso que mossos y municipales habian en abundancia y no es que tuvieran demasiada faena, este comentario lo hago para que os deis cuenta que la realidad no es la que os inventais si no la del dia a dia y la verdad,que a mi un trozo de trapo me la suda, pero en mi casa hablo lo que quiero, cuando fuera hablo lo que debo, segun la circunstancia ,no somos nosotros el problema sois vosotros y vuestra imaginacion

  215. Rosita si es imaginación, ¿porqué zp dijo en la entrevista a Francino que ya colgué aquí(tómate la molestia de abrirlo, querida)dice que está a favor de multar a quien rotule sus negocios en español? Se lo habrá imaginado.

    El señor al que han multado con 400 euros por rotular en español su negocio, cuyo vídeo ya colgué más arriba, ¿también se ha imaginado la multa con documentación imaginada que aportaba?

    Y la huelga de hambre de aquel señor para exigir que su hija fuera escolarizada en español y al que luego apalearon, también es imaginación?

    Y las palizas que todos hemos visto a candidatos no nazionalistas y los impedimentos mediante la violencia, para que los no naZionalistas pudieran hablar y dar su mitin ¿era una imaginación colectiva, lo que todos hemos visto?

    Rosa, por Dios, ¿a quién quieres tomar el pelo?

    Es que ya es el colmo negar la evidencia

  216. He recibido tu mensaje. No voy na leerme todos los comentarios que te han dejado Rosa y el otro que no recuerdo como se llama. Si te he de ser sincero me da mucha pereza.

    Porque no actualizas el blog y escribes otro artículo. Entonces discutimos lo que quieras.

    Venga saludos

  217. Miquel:


    No me digas que no te acuerdas de Fan Fatal porque no me lo creo jajajajaajaajaajajaajaja y el otro, que es de estos castellans ximples que tanto os gustan, se llama Boigandreau.

    Quieres que actualice, pero es que estoy tan absolutamente asqueado que no me salen nada más que exabruptos contra los naZionalistas, contra z y hasta contra Rajoy.

    ¡Alégrate, hombre! Es una buena época para los naZionalistas como tú… si hasta Marianico quiere que le caigáis simpático! Ya sé que es imbécil, no hace falta que me lo repitas, pero es que estos de la derecha eXpañola son así de ximples.

    Bueno, nen. ¿Qué quieres que te diga? Espero recobrar las ganas pronto.

  218. Pues en vistas de lo que son tus ganas, mentiras, en vista que de 1 solo comntario os montais una historia, viendo que creesis mas a cuatro interesados que a la sociedad entera. dandome cuenta que da igual lo que se os diga que sois de ideas fijas y que lo que opine el difeente esta equivocado seguro, la razon es vuestra y por el mero echo de ver en cueros a Rivera, oir las sandeces de Boadella, os creeis amos i señores de la razon, pues que os aproveche, disfrutad de quienes no conoceis, de quienes ni siquiera han intentado un dialogo con vosotros, de los que se han hecho martires por histeres, disfrutarlos, porque la verda la vida para mi es mas que cuatro gilipollas diciendome si pueso o no hablar mi idioma, hablo lo que quiero viajo donde me da la gana, tengo amigos de muchos lugares y no me da la gana de discutir mas tonterias, ¿no se que os creeis? pero ha estas alturas lo que discutimos da pena, que os vaya bonito, y cuidado con el hambre en el mundo, la poca cultura la desigualdad de la mujer, y un largo etc que no son importantes , lo importante es hablar una lengua minoritaria que a ciertos personajes no les cae bien, pues mira ancha es Castilla, practicar vuestro Castellano porque en las demas regiones de España mal que os pese hablaremos nuestras lenguas, que os vaya bonito

  219. Rosa:

    ¡Qué lástima, guapa! Cuántas veces has intervenido, y cuántas veces has leído por encima lo que Fan Fatal y yo te hemos ido escribiendo.

    ¿Cómo se te puede decir que nadie te impide hablar en catalán -que, por cierto, no es tu lengua, maca- cuando te dé la gana? ¿Cuándo ha dicho eso Fan Fatal o lo he dicho yo?
    Nena, quina llàstima, maca, pero haz lo que te salga del -y, perdona que sea tan plástico- del potorro. Estoy hasta los mismísimos de repetirte una y otra vez lo mismo.

    Un beso, hermosa.

  220. Lo de esta mujer es de traca,le muestras vídeos,declaraciones de personas agredidas o multadas, hasta las declaraciones del presi de sus amores diciendo que le parece bien que se multe a los comercios que rotulan en español, y resulta que la buena señora sigue diciendo que son invenciones del PP y de Boadella.

    Para mear y no echar gota…

    Eso hermosa, a mirar para otro lado, y a decirnos que es mentira, al final nos querrá convencer de que la tierra es cuadrada y se quedará tan ancha.

    Anda que….

  221. He leido los comentarios a partir del mío.

    Boadella no es mas que un payaso histriónico que ha visto que con sus pésimas obras no se ganaba la vida en cataluña y ha decidido cobrar de españolitos atontados y chenófobos a base de decir sandeces.

    Si el tío es muy listo, mediocre, pero listo.

  222. Miquel:

    Sin duda Boadella está en más o menos momentánea crisis creativa, quizás sea por la edad, quizás sea por el consancio o el hartazgo -Ay, Dios, cómo le entiendo- pero mediocre no es.

    Curioso cómo los naZionalistas echan pestes de él ahora, cuando en la época de la transición y en la época del tardofranquismo era la cabeza visible de los catalanistas e incluso de los nacionalistas decentes, si es que de eso hay o había. En cuanto le vio el plumero a Pujol y al pujolismo, sus corruptelas y sus megalomanías, todos los intelectuales catalanes mamadores del pesebre, que antes eran sus amigos íntimos, le dieron la espalda.

    Es curioso que incluso tú, Miquel, jove naZionalista de esquerres, pro Terra Lliure i republicà, ataques a Boadella que es la bestia negra de Pujol. Pero es que los naZionalistas en el fondo no sois ni de derechas, ni de izquierdas, sino ximplement pro naZió catalanlla y ya está.

  223. ¡Son la monda los naZionalistas periféricos estos! ¿Boadella es mediocre,? claro, y Sabino Méndez hace canciones tan”malas” como El ritmo del garaje” o “quiero un camión” además de escribir “malísimos libros españolistas” como: Corre rocker corre. Y por supuesto Loquillo es “malísmo” cantante.
    Por supuesto Sergi Arola es un “nefasto” cocinero y….

    Pero… ¿el sectarismo de esta gente no tiene límites? aquí si difieres de los paleolíticos nazis que habitan cataluña, resulta que tiran tu profesionalidad por los suelos. ¡Increíble!

    Un poquito de buena música española que marcó una época:

    Lo siento pero el “talento” de Marina Rosell o Luis Llach me revuelve hasta el esófago.

  224. Sinblanca. Un par de cosas.

    Como tu has dicho Boadella era catalanista. Supongo que mas por interés que porque tenga ninguna idea en la cabeza (que no sea salir en la tele, claro). Cuando vio que ser catalanista no hacía crecer la audiencia para sus pésimas obras se pasó al españolismo descaradamente.

    Ahora este señor tiene su dosis de dinero y televisión.

    Una puntualización: no se como no te has dado cuenta aún, pero yo no soy de izquierdas. Sinceramente, las izquierdas son internacionalistas (obrerismo, multiculturalismo y blablabla). Un nacionalista reconoce la diferencia, no la homogeneiza.

    Un saludo

  225. Aquí tienes mi autodefinición que colgué en mi página. está en catalán, con el word puedes traducirla:

    Em considero una persona nacionalista (no de la manera que usen el terme certs mitjans de comunicació per definir qualsevol persona independentista o que vol més autogovern sinó de la manera tradicional i romàntica), independentista (com crec que és lògic de qualsevol nacionalista d’un país sense estat) i de centre, ja que considero que no es pot aplicar una ideologia social a tot arreu i sempre igual, sinó que cada lloc i moment necessita les seves pròpies mesures, ja siguin més liberals o menys.

  226. cuando uno le remueve algo el estomago vomita, osea que ya lo sabes,todos lo hacemos,y es lo que suelo hacer cuando oigo o leosegun que cosas, por cierto deplorables,

  227. Miquel:

    Pues chico, qué decirte, más coherente no puedes ser. Me confundiste un poco por tu relación con Dessmond y la cena con Carrataru y otros borrokos de ERC.

    Me parece muy bien que tengas las cosas claras. Lo que no se puede ser es de ¿izquierdas? como los de ERC o IC o, si me apuras, los de ETA, y ser nacionalista.

  228. Cada día estoy más orgulloso de ser catalán, nacionalista, independentista y de poder reirme a diario de la Spain del torito y olé.

    Qué alivio, macho!

    Gracias por esta web. Me anima y me felicita a diario.

  229. visca catalunya independent d’espanya i de gent com tú

  230. Rafael Bosch:

    Bienvenido a mi bitácora.

    jajajajajajajajaaja ¡Qué cachondo eres!

    No eres el único naZionalista que se corre con mis entradas.

    Gràcies, maco. Ho faig per tu!


    Bienvenido a mi casa.

    Por favor, cuanto antes mejor.

  231. Soy catalán, pero la lengua catalana es una puta merda; es más, es una gran puta merda (mierda). Hablo indistintamente el catalán y el castellano, aunque prefiero hablar en este último. No soporto leer en catalán (tan mierdoso como el francés) y menos escribirlo. He estado toda mi vida yendo a septiembre por culpa de esta lengua, que si ahora un “guionet”, que si ahora “accent obert”… que asco de lengua!! Si hay algo que habría que exterminar de Cataluña es el catalán, me refiero a la lengua.

    • ¿Y si te pasa con las mates también?, que tu seas un besugo no es motivo para que desaparezca ningún tipo de cultura.

  232. Opusdiaboli:


    Me encantaría que este comentario lo leyera Miquel y otros amiguitos naZionalistas catalanes de por aquí.

    Ya era hora de que un catalán oprimido por los naZionalistas dijera lo que todo el mundo piensa y no se atreve a decir.

    Bueno, lo de exterminar la lengua es un decir y tal, pero ol’e tus mism’isimos, Opusdiaboli!

  233. Anda que escuchas a uno bueno…

  234. Kabish:


    Pero si estás vivo. Y yo que te hacía perdido entre tus amici italianilamentándoos del triunfo de Berlusconi…

    ¿Qué tiene de malo Opus? Seguro que dices lo mismo de mí por ahí, pillín.

  235. Por supuesto, lo de exterminar el catalán es un decir, pero no tanto decir. Está muy bien hablar muchas lenguas, pero hay que ser prácticos y racionales, se pueden estudiar otras materias más útiles que el catalán, al menos en la Universidad. Lo mejor sería que se estudiara como asignatura de Libre configuración y que la curse quien quiera (los que votaron sí al Estatut), pero no como troncal. Claro que la esencia del saber no radica en la utilidad, pero hay tantas materias que podríamos desprendernos de algunas como el català.

  236. Hola escòria opusina. Suposo que l’amic Sinblanca esborrarà el missatge però espero que no ho faci abans de que el llegeixis.

    Tu si que ets una gran i fastigosa merda i ets tu el que mereixes ser exterminat. Si la teva intel·ligència no arriba a aprovar el català (suposo que el castellà és més senzill ja que si un orangutan com tu no el suspen ha de ser una llengua a prova de deficients).

    Catalunya estaria molt millor sense tu, o sigui que planteja’t emigrar, i ràpid sisplau.

    Trobo que els exterminis són coses repugnants, però sol llegir-te he pensat que potser tu mereixeries una excepció.
    Después me dices, Sinblanca, que el españolismo del que hacéis gala no es nacionalismo… Es nacionalismo del peor: conquistador y negador. Nosotros nos protejemos de vuestros ataques. En mi caso con la misma dialéctica que usais vosotros, ya que odio la tebiez de muchos patriotas catalanes. Espera a que tu amigo lea el mensaje antes de borrarlo. Saludos

    Traducción de Sinblancaporelmundo:

    Hola escoria opusina. Supongo que el amigo Sinblanca borrará el mensaje, pero espero que no lo haga antes de que lo leas.

    Tú sí que eres una grande y asquerosa mierda y eres tú el que te mereces ser exterminado. Si tu inteligencia no llega a aprobar el catalán (supongo que el castellano es más sencillo puesto que si un orangutan como tú no lo suspende debe ser una lengua a prueba de deficientes).

    Cataluña estaría mucho mejor sin ti o sea que plantéate emigrar, y rápido por favor.

    Encuentro que los exterminios son cosas repugnantes, pero tras leerte he pensado que quizás tú merecerías una excepción.

  237. Opusdiaboli…si el catalán es la lengua que se usa cotidaneamente en Cataluña, y se habla también el castellano, ¿no será mejor aprender las dos, como oficiales que son ambas, y ser más rico culturalmente?Tú, quizá, no la quieras estudiar, otro quizá no quiera estudiar el castellano, pero ambos os dais de frente con la oficialidad y el uso cotidiano de ambas lenguas…glub!

    Miquel….¿tienes alguna senyera para que la vomite?Vengo de limpiarme el culo con la española, pero tu asqueroso odio me ha dado tantas náuseas que el que va a acabar exterminado es mi lavabo. No sabía que guardabas parentesco con Dios, lo digo por tu razonamiento (neardental, por otra parte) acerca de quién debe y quién no debe ser exterminado. Empezó opusdiaboli, que parece que tiene tu problema patriotero, pero invertido. Pero no tienes excusa para decir dónde y cómo tiene que vivir nadie. Haz lo tuyo, preocúpate de vivir tu vida y disfrutarla, sea en catalán, en castellano o en zambiano, pero no caigas en el error de quién ataca tu cultura, y ataques por los mismos frentes y con las mismas tretas…¿no te parece hipócrita tu postura?¿Y la tuya, opus, no t parece también hipócrita?

    Estais luchando por dos trapos!!Me la pelo…

  238. jajajajajajajajajaajajajajajajajaja

    La meua benvolguda mare no escriuria un català tan horrorós com el que escrius tu, que no és ni català, ni valencià, ni castellà. Més aviat una barreja inculta dels tres. Llavors, és per això i no pels insults pel que el teu comentari va derechito al Cubo de la basura.


    Mi querida madre no escribiría un catalán tan horrendo como el que escribes tú, que no es ni catalán, ni valenciano, ni castellano. Más bien una mezcla barriobajera de los tres.

    Entonces, es por eso y no por los insultos por lo que tu comentario va derechito al Cubo de la basura.

  239. Tanta cola para nada… no vale la pena contestar porquè lo que tu necesitas es un psiquiatra. 😦

  240. Miquel:

    Bueno, y ¿qué es lo que quieres decir?

  241. Este Miquel no soy yo

  242. El naZionalismo catalán es insolidario, ombliguista, provinciano y nocivo espiritualmente. Y nos da mal nombre a los catalanes.

    Saludos España. Saludos, sinblanca (y que te toque una quinielilla para que le puedas cambiar el nombre a tu blog: “Conpastasuficiente por el mundo”.

    Soy catalán, reitero.

  243. “El naZionalismo catalán es insolidario, ombliguista, provinciano y nocivo espiritualmente. Y nos da mal nombre a los catalanes.”
    quienes os dais mal nombre sois vosotros mismos al votar esas opciones, según eso, estás diciendo que sois un pueblo de ignorantes.

  244. No, por mi parte yo lo digo desde mi mentalidad anarquista de juventud. Como cristiano tampoco me parece normal el nacionalismo excluyente e insolidario. Hay que ser más internacionalista, más universal, ir añadiendo fronteras a las que ya hay me parece una tendencia inversa a la comunión entre las personas (y con Dios).

    Yo puedo respetar un nacionalismo como el de Gandhi, es decir el nacionalismo pacifista indio anticolonial, pero apoyar a CiU, PNV , etc, me parece propio de gente egoísta.

  245. La tierra en que naciste no es el centro del mundo, ni la mejor. Simplemente, es la tuya. Con lo qual, el respeto por el vecino siempre tendria que estar presente.Si estos españoles nacionalistas, catolicos algunos, defienden su tierra i su lengua, asta el extremo de eliminar qualquier tipo de cultura, tradiciones i lenguas, que no sean la española. Pues vaya pais de desmemoriados que tenemos. No se acuerda nadie que españa fue sometida por los arabes. Que por nuestra sangre tambien corre sangre arabe.
    Pues para este pais de pura casta, mejor seria que se quedaran los de pura casta i los demas nos marcharamos. Con esto tambien incluyo al Rey de sangre Francesa i una Reina Griega.
    Bon dia a Tot-hom

  246. Para vuestra información. El imperio Romano desenvarco en las costas mediterraneas, por el Este. Al igual que su lengua. Con lo qual, el idioma español es mas joven que el CATALAN. ya que por antiguedad el catalan es descendente directo del LATIN i por años desenvoco en una nueva lengua, el español. Asi que quien deriva de quien??? A QUE JODE, ESPAÑOLITOS. Haber si antes de hablar mirais un poco mas alla de vuestro culo.

  247. Harchy:

    Bienvenido a mi casa.

    Chico, ¿de qué frenopático te han dejado salir, macho?

    Antes de opinar sobre cosas filológicas, mira lo que has escrito:

    Desenvarco, debería ser: Desembarcó.
    Mediterraneas, debería ser: Mediterráneas.
    Mas, debería ser: Más.
    CATALAN, debería ser, CATALÁN.
    Antiguedad, debería ser: Antigüedad.
    LATIN, debería ser: LATÍN.
    i, debería ser: Y
    Desenvoco, debería ser: Desembocó.
    Asi, debería ser: Así.
    Quien, debería ser: Quién.
    Haber, debería ser: A ver.
    Mirais, debería ser: Miráis.

    Chico, deberías ir a la casa de Pujol y ponerle una bomba que le hiciera estallar en mil pedazos -es sólo un decir, ¡eh!. que capaz eres de hacerlo y tengo a la New Scotland Yard en mi casa-. Lo que han perpetrado veinte años de pujolismo en Catalunlla NO tiene nombre, o más bien, tiene uno: HARCHY.

  248. Tengo mejores cosas que hacer, que aprender bien, o repasar lo que escribo. Prefiero aprender inglés o alemán, que una lengua que se impone ante la lengua paterna en Cataluña. Por esto mismo que tu intentas corregirme, empieza el odio. Verdad que si fuera extranjero. No intentarías corregirme con esta chulería. Creo que mejor dejarlo…

  249. También creo que tú tendrías que pertenecer algún tipo de asociación falangista, dar clases de literatura i lengua española. Por que ya veo que para ti, es más importante como se escribe que lo que opina la gente opina. Pues así nos va. Somos un gran país delantero en I + D, en todos los campos, tanto tecnológicos como médicos…
    Todo gracias a gente como tu.

  250. Harchy:

    Noy, zensa kumantaris, macu.

  251. visca catalunya lliure

  252. Pope:

    Visca Catalunya lliure dels naZionalistes!

  253. Cataluña será siempre una comunidad autonoma o región ,de nuestro y querido estimado país llamado ESPAÑA. Y se lo dice uno que vive en una Cataluña, región en la actualidad y desde siempre poco democrática de CAROD’S ROVIRAAS Y MONTILLAS.
    Yo no fui a votar ese ESTATUT FASCISTA.
    Yo hablo catalán y Español y no soy fascista como dicen muchos. Los únicos fascistas y racistas son los nacionalistas e independentistas.

  254. Mac tu hablaras Catalán y Castellano ya que el Español es el compendio de todas las lenguas habladas en España, o sea que cuando hablas Catalán o Gallego o cualquier otra lengua propia de una autonomía Española ya hablas Español, el Castellano proviene de Castilla y mas claro el agua

  255. Sinblanca:

    Visca Catalunya lliure dels naZionalistes espanyols.

  256. La veritat és que no sé com piqueu d’aquesta manera.
    Contestar a un provocador desinformat no és propi de gent intel.ligent.

    És la història de sempre: Espanya dóna pel cul, Catalunya s’emprenya i reacciona, li fan la foto i ens la publiquen amb el peu següent. “Un nacionalista intolerante increpa a un español de bien”.

    A prendre pel sac!

  257. David, no tu prengis aixi, es mas facil tenir amics que enemics i a la llarga esta estadisticament demostrat que si es propi de gent inteligent, demostra a qui no pensa com tu que no ets el dimoni ajuda, pero ajuda molt mes que insulta i falta al respecta, crec que est molt jove i jo molt gran i a gat vell no li digis mixa, temps al temps i mu diras

  258. que se’n vagin a fer punyetes aquests antiCatalunya

  259. Mucha represión y muchas hormonas se ven por aquí…

    Cuando el ser humano se de cuenta de que intenta justificar racionalmente aquellas cosas que son totalmente irracionales

    como el nacionalismo
    o la fobia a los homosexuales,
    a catalunya (o a españa, a euskadi),
    o a los negros (o a los blancos)
    o a los árabes (o a los cristianos)

    habremos avanzado mucho en la resolución de conflictos y tal vez un futuro más brillante nos espere. Mientras tanto, sigamos dividiendo y desuniendo y mirando las diferencias en vez de las similitudes.

    Para el que todavía se autojustifique racionalmente, que consulte los experimentos de Edward Bernays de casi ya un siglo o que lea un poquito de psicología reciente. Freud ya estaba bien encaminado.

    Besos para todxs

    PD: Para el bloguero. Está claro que te gusta provocar y ver cómo la gente se mosquea, más que dar un punto de vista. No tengo en nada en contra de ninguna opción sexual, política o religiosa. Lo que no me gusta es la gente que rezuma represión y odio, no hace más que generar energías negativas. Eres el maltratado maltratador?

  260. Basurilla:

    Ni maltratado, ni maltratador.

  261. Siempre es duro arrepentirse y más aún de los ideales de juventud, nosotros los nacionalistas catalanes nunca hemos engañado a nadie, creemos en la nación catalana y queremos para ella un estado, ser un país más en el mundo, y respetar a todas las gentes de todos los pueblos; nunca nos hemos escondido de eso.

    Lo que pretendo para ti, amigo, es que te sinceres i definas contigo mismo, te voy a poner un ejercicio.

    ¿Te parece correcta la ocupación militar del Tibet por parte de China?
    Me temo que tu respuesta va a ser NO.

    ¿Te parece correcta la posterior ocupación civil china?
    Aqui temo que vas a dudar, todo el mundo puede ir dónde quiera, yo estoy contigo, pero esta nueva gente van a apoyar las ideas independentistas del Tibet?

    ¿Cuanto tiempo tiene que pasar para que el Tibet ya no pueda reclamar un estado propio y tenga que pasar definitivamente a formar parte de China?
    1 año? 40? 100? 300?

    ¿Un referendum sería lo más democrático?
    si es así, al Tibet le queda poco tiempo porqué de chinos los hay a millones.

  262. Viur elliure-muy bien, espero que sin blanca libre de opresiones te conteste, por cierto, sin blanca, recuerda Barcelona existe, es una ciudad Mediterranea (al igual que Tarragona i Girona) no pierdas el tiempo en el triste Londres, con todos mis respetos, tu sabras, pero creo que deberias volver estas depre

  263. tu! minyona tengueràs una resposta a les tues preguntes

  264. no comprenc la tua manera de eser!!!!!!!!!!! la tens amb lo mon o calqui u en particular? o se’s una manipolaciò polìtica? reixis a viure amb tranquil.litat? i sense fer-se odiar ? perquè fàs això?

  265. oh minyona (noia) !!!!!!! Parla-me en català!!!!!!! no’l comprenc l’espanyol!!! tu lo català lo parlas i l’escrius molt bè! una cosa te vul preguntar! tu se’s catala o espanyol de catalunya?

  266. Bueno, Paolo, maco. Gràcies per tractar-me de minyona, encara que no sóc senyora sinó cavaller, molt marieta, això és veritat, però cavaller al cap i a la fi. Però si et sents millor tractant-me de dona, tu mateix.

    Sóc espanyol i punt. A mi les diferències regionals, els aditaments i florituretes locals, les senyeretes de fa un segle quan no de fa vint anys, em rellisquen. Jo sóc espanyol i ja està, res més. Sento tan meva La Moreneta com La Macarena, Dalí com Picasso, els boscos de Galícia com les terres volcàniques de Lanzarote i deteste per igual a Sabino Arana com a Franco, a Prat de la Riba com a Rubianes.

    M’estranya molt que no entengues l’espanyol. Sent de Sardenya d’origen espanyol (català), tenint com llengua materna el català molt castellanitzat de l´Alguer, suposant que sàpies sardo i italià; suposant que hages estudiat anglès a l’escola o tal vegada francès fins i tot, em sembla molt improbable que no entengues castellà, almenys l’escrit, però com tu així m’ho assegures, doncs t’escric en catañol que és el que jo escric i parle quan use la teva llengueta.

  267. escolta noia! siguis lo més clar possible! que no te comprés!

  268. clara volia dir! dat que se’s una noia

  269. Paolo, jo soc Catalanista, sin blanca i jo no tenim res en cumu, pero considero que te dret a pensa com vulgui, si no ofent a ningun, la seva sexualitat es seva i ni a mi ni a tu ens afecta, be a mi no m’afecta a tu ¿no hu se? ¿a lu millor et posa? pro vull que entenguis, per defendre Catalunya mai et dire res, per ofendre a una persona per la seua sexualitat si, el respecte pels alltres es sagrat

  270. decirle a sinblanca un par de cosas:

    L’origen del català a Sardenya prové de fa molt més de 300 anys, o sigui que no té res a veure amb Castella i molt menys amb España perquè ni tant sols existia. Obre una mica més la teva ment i descobriras que afirmar que el català és español és com afirmar que és francès, i si no viatja fins a Perpinyà.

    Tu que eres tan liberal:
    Español lo eres ahora, y podrías seguir siendolo si Cataluña se independizara.
    Yo soy español por obligación i sería libre si pudiese ser catalán.
    Tu eres más que un ciudadano español, eres un ciudadano opresor español.

  271. Viurelliure:

    Me encanta la facilidad con la que me calificas y lo bien que los tienes puestos -¡qué morbo me das, guapetón!- al llamarme opresor porque no estoy de acuerdo en la independencia de Catalunlla.

    Seguro que tú te sientes muy demócrata impidiendo que mis hijos se eduquen en la lengua de sus padres como a vosotros se os lo impedía en la época franquista, pero claro eso te parece normal.

    No me digas que viaje a Perpillá porque he estado allí numerosísimas veces. Allí nadie habla catalán ni lo quiere hablar, ni lo quiere aprender. Allí sólo lo hablan los gitanos del barrio antiguo que son gente de un nivel cultural ínfimo a parte de estar casi siempre fuera de la ley.

    Claro que el catalán no es castellano, pero sí español, como el valenciano no es catalán, pero sí español. Y claro, el sardo, por ejemplo, está llenísimo de palabras castellanas, como el napolitano o el siciliano; es normal que el alguerés tenga incluso más, ¿no crees?

    Tú se lo que te dé la gana, yo también lo seré. Ten en cuenta que por ahora sois tan fuertes porque la mayoría del pueblo español fuera de Catalunlla no cataloga a los naZionalistas vascos y catalanes como verdaderos enemigos suyos, que no quieren sino la destrucción de España y la expoliación del dinero de todos los españoles para sus empresas naZionalistas. Cuando los españoles se den cuenta de una vez de que por culpa vuestra, los españoles no son iguales en todas las partes del país se os borrará del mapa. Y no estoy diciendo que se os matará -como vosotros lo habéis hecho y lo hacéis- sino que democráticamente los votantes del PP y del PSOE se unirán para que no tengáis ningún poder. Entonces vete preparando para llorar y sudar la gota gorda, maco.

  272. He tenido un lapsus en el escrito anterior y pidiendo disculpas a los ciudadanos españoles que comprenden la necesidad del pueblo catalán de tener un estado propio, con el catalán cómo idioma oficial cómo la normalizada Andorra, debería haber puesto:

    Tu no eres un ciudadano español.
    Tu eres un ciudadano opresor español.

  273. Viurelliure:

    En fin, chico, tú mismo, ¿qué decirte?… bueno, pues que contra el cerrilismo no parece haber cura. En fin, nen, sigue paciendo lliure que yo no seré quien intente hacerte bajar del guindo antes de que te caigas y te rompas la crisma. Ya no.

  274. Gracias, veo que por fin lo has entendido:

    Que aunque me veas pequeño y vulnerable es el momento de saltar del nido y probar de volar, esto es amor.

    Es muy adulto de tu parte ver que ya no necesitamos los “consejos” y “protecciones” de papá y mamá España.

    Debe ser dificil despegarse de lo que tu habías adoptado cómo un hijo, para mi también lo es (aunque yo tengo la ilusión de los nuevos horizontes) no te abandono, me cambio de casa. Ven a verme cuando quieras que io también vendré.

    Cuida’t! adééééu

  275. Sin blamca te pasas un huevo, los Catalanes tenemos derecho a opimar lo que queramos de nuestra tierra y si algunos quieren la independencia, ni tu ni nadie teneis derecho a imponeros

  276. Potato, guapo, tu comentario al Cubo de la basura.

  277. No puedo entender la rabia que le teneis a la democracia catalana. Esto es lo decidimos los ciudadanos catalanes, y nosotros no tenemos que decidir qué hacer con nuestro país (región o llamadlo como queráis) pensando en lo que pensará un madrileño, un extremeño o de dónde sea… nosotros (y los castellanohablantes de aquí también) somos los que decidimos que la educación sea en catalán, y si algún día llega el momento, deberías aceptar que no queramos seguir formando parte de España.
    Y por favor sinblanca, no nos digas que nosotros hemos matado a alguien, que nosotros no tenemos la culpa de que haya descerebraos en todas las partes del mundo. O a caso encuentras justo que yo te acuse de los crímenes del franquismo? Además en Catalunya ya no existe ninguna organización terrorista, o sea que además de ser un argumento demagogo está obsoleto.

  278. Y si en Perpinyà casi no se habla catalán es por culpa del centralismo francés, que nunca ha dejado que se aprendiera el catalán, aunque sí que lo habla una minoría más grande que la que tú dices y si te vas por los pueblos de alrededor se habla muchísimo.
    En este sentido, España trató mejor el catalán que lo que hicieron los franceses, pero también porque allí eran una región mucho más pequeña y no tenían la fuerza suficiente para defender su cultura (igual que los occitanos, que se han cargado su lengua).
    Quizá pienses que todos los países deberían cargarse las lenguas regionales, pero esto es cargarse la riqueza cultural.

  279. Joan:

    De acuerdo, empezad retirando al Barcelona de la liga espanhola. Vale?

  280. Por cierto decir que el catalán de l’Alguer (Sardenya) está castellanizado es una muestra muy grande de incultura… El catalán de Sardeña está mucho menos castellanizado que el de Cataluña, porque hace como 400 años que no convive con el castellano! Está italianizado o sardeñizado, pero nunca castellanizado, vaya burrada…

  281. Esto sinblanca no es un argumento ni es nada… yo desde mi posición te puedo decir que estaría dispuesto a esto. Pero la cuestión es si tolerarías que hubiera una mayoría que quisiera la independencia (que por cierto una encuesta reciente apunta a que sí). Encuentras justo que no exista el derecho de autodeterminación, del derecho de una región a decidir su futuro? Según la ONU me parece recordar, debería ser un derecho universal…

  282. Joan:

    Claro, tambi’en estar’ia dispuesto a que Barcelona, que es mayoritariamente castellanohablante, se separara del resto de Catalunlla, por ejemplo.

  283. Joan:

    En cuanto al catal’an de El Alguer… Vale, no est’a tan castellanizado como el de Catalunlla, pero es que tiene cosas muy castellanas… En Alguer’es no s’e tanto, pero en Sardo dicen Adi’os, por ejemplo, y cosas que suenan muy, muy castellanas. Como en los dialectos de N’apoles y Sicilia que tal pareciera que te est’an hablando en castellano.

    Y en cuanto al refer’endum. Bueno, bien, tal vez, pero dentro de unos anhos si sale independencia quiero que tambi’en exista la posibilidad de otro refer’endum de vuelta a la casa hisp’anica, no te parece? Y si no sale, habr’ia que tener una posibilidad de que lo hubiera en otros anhos hasta que por fin logremos que Catalunlla volviera a Espanha… y una vez de nuevo en el seno de la patria, habr’ia la posibilidad de hacer, tras anhos, otro refer’endum de independencia… y suma y sigue.

    Y claro, si no est’as de acuerdo con eso es que no crees en la democracia, ni en derecho de autodeterminaci’on…

  284. Ok, entonces estás de acuerdo con el derecho de autodeterminación y con la capacidad de autonomía de las regiones pero te quejas que se nos ha dado demasiada autonomía, autonomía que no llega ni mucho menos al nivel que nosotros pedimos.
    Creo que no tenéis derecho a opinar sobre la autonomía que queremos tener. A mí me da igual si el pueblo de Aragón prefiere gobernarse totalmente a sí mismo, pero creo que si quisieran tendrían que tener todo el derecho. Por eso no entiendo que haya tanto afán de gobernarnos des de Madrid.

  285. Claro que creo que si se llega a la independencia y hay un movimiento lo suficientemente fuerte para volver a formar parte de España se tendría que celebrar otro referéndum, y aceptaría el resultado.

    Otra cosa es que creo que si hubiese este movimiento tendrían que pasar unos cuantos años para que se diese otro referéndum para que los ciudadanos puedan juzgar qué modelo prefieren

  286. Joan:

    Tu naci’on catalana es un fraude, mira aqu’i:

  287. Es un video muy malo, es un coñazo, la verdad es que no he podido acabarlo de ver.

    Y da igual, porqué en ese video sólo se habla del pasado, y a mi el pasado me la suda, yo miro el presente i sueño hacia el futuro con ilusión y sin rencor, creo en un futuro en el que Francia y España sean vecinos sin tener que gobernar el pueblo catalán, porqué es ahora y no ayer que queremos un Estado propio.

    Y quien viva en Catalunya luchando contra eso debe saber que es un chino prepotente caminando por el Tibet con aires coloniales.

  288. Viurelliure:

    Yo es que me parto con vosotros:

    Primero manipul’ais la historia para dar una base y un sentido a vuestros deseos de independencia. Despu’es, cuando los historiadores os desenmascaran, entonces dec’is que el pasado, o sea, esa historia de agravios y humillaciones, ya no importa, que lo que importa es el futuro.

    De veritat, nen, fes-t’ ho mirar!

  289. Bueno, al fin lo he escuchado todo. Ponemos por ejemplo que creo que todo lo que dice el hombre en el video es verdad. Lógicamente no le puedo rebatir porque no soy historiador y no me gusta hablar de lo que no sé, pero a parte de que el 11 de septiembre esté mitificado (que estoy seguro que lo está, aunque se tendría que comprobar en qué grado y contrastar lo que dice), esto no me quita razones históricas, si es lo que buscamos aquí. Este hombre se queja de que los catalanistas vamos saltando de argumento en argumento y omitiendo hechos como la mitificación del 11 de septiembre, pero él también omite muchas cosas, como es el hecho de que después del 11-S el catalán fue prohibido y que Catalunya no volvió a tener un gobierno autónomo hasta el siglo XX, y no sólo esto, sino que lo tuvo por poco tiempo porque después vino el franquismo y todos sabemos lo que conllevó. A mi no me importa que Catalunya nunca fuera independiente tal y como yo lo pido ahora, no creo que esto fuera un buen argumento para querer ser independientes, lo que importa es que la voluntad de Catalunya nunca ha sido respetada des de España. Ésta para mí es una razón histórica suficiente. Y si lo que vamos es al presente, pues te doy más o menos la misma razón, que los catalanes queremos más autonomía pero España quiere seguir gobernándonos. Si España hubiera sido federalista y no se hubiera tenido la voluntad de gobernar des del centro a todos, creo que no tendría la necesidad de quererme independizar, porque al haber sido un gobierno más respetuoso probablemente me hubieran hecho querer a España.

  290. na Galiza em Galego!

  291. Joan:
    Volvemos al principio. Comenzad retirando al Barça de la liga española y seguid con las sucursales de La Caixa, entonces hablamos…

    Lo demás son tonterías. Independizaos vosotros de verdad. No publiquéis nada en español, todo en catalán; La Vanguardia, El Periódico, etc, todo en catalán. No produzcáis ninguna peli en español, todo en catalán… Cuando hagáis eso, me creeré que queréis ser independientes. Mientras tanto creeré que sois una panda de tocapelotas y traidores, sobre todo, esto último.


    Paréceme moi ben. Tanto en galego como en castelán, nos dous, ¿vale, guapo?

    O que máis me interesaría saber, non é sobre as polladas independentistas, senón saber se ti es galleguista ou reintegracionista no portugués.

  292. Chico, t’u eres de la escuela de la Mar’ia Antonia Iglesias. As’i que tu mensajito va al Cubo de la basura.

  293. Sinblanca, que no te enteras:
    Catalunya si fuera independiente seguiría siendo un país bilingüe, con las mismas personas que viven ahora mismo en ella, la Vanguardia seguirá publicando en castellano si ellos quieren, y nosotros seguiremos sin producir ninguna película, porque es desde Hollywood que se decide en qué lenguas se produce.
    Y la verdad, ya me está empezando a cansar esta conversación, te estoy dando argumentos que tú ni intentas rebatir y me sales con bobadas cómo esta.

  294. es que la verdad que tu último post da pena, no hay por dónde cogerlo…
    Yo si quieres puedo tener una discusión civilizada contigo como te he demostrado todo el rato, pero decir cosas como que la Caixa no tendría que tener sucursales en España… por favor… que la Caixa no representa Catalunya, y poniendo por caso que fuéramos independientes, por qué no tendrían que poder tener sucursales en España?

  295. Joan:

    Pues mira t’u, qu’e bien. As’i que quer’eis ser independientes, pero no. Quer’eis pasar del castellano, pero no. No quer’eis ser espanholes, pero quer’eis seguir disfrutando de La Noria y de la Mar’ia Antonia Iglesias. Pues no.

    Si os independiz’ais, Adi’os. Adi’os. No queremos saber nada de vosotros…

    Bueno, en mi caso, yo ya he pasado de vosotros desde hace muuuuuuuuuuuuuuucho tiempo.

    Y en cuanto a La Caixa, ni muerto pondr’ia yo mis ahorros en manos de gentuza tan gentuzona.

  296. Mira ya no tiene ningún sentido intentar razonar contigo… estás empezando con tonterías de gran calibre… Sólo te diré por enésima vez que independizarse no es pasar del castellano porque no es echar a los castellanos de aquí, y que todas las formalidades que dices me la sudan, que no puedo ver Tele 5, pues muy bien (aunque sabes que las cadenas españolas no renunciarían a la audiencia de Catalunya), que ningún español quiere poner el dinero en la Caixa, pos vale, ni que fuera el hijo del director… todo esto son tonterías típicas de una rabieta.
    Y no digas que pasas de nosotros, ya nos gustaría que pasases, que parases de decir tonterías y que respetases lo que pensamos.

  297. Joan:

    Pero qui’en te dice que no respeto lo que piensas? Claro que s’i. Aqu’i escribes lo que te da la gana.

    Yo lo que quiero es que pas’eis de nosotros por completo, pero de verdad, no con medias tintas. En la Catalunlla independiente nada de castellano, ni de mercado espanhol para los productos catalanes. Adi’os es adi’os.

  298. Mira que ya lo intentaron los portugueses, y ni por esas les dejan los españoles tranquilos.

  299. Braulio Foz:

    Braulio, bonito, Que chatos sois os portugueses, realmente. Se Pessoa e Camões levantassem a cabeça, voltar-se-iam às suas tumbas arrepiados por ti.

  300. Pues España pensaba en Portugal para apoderarse de toda la Peninsula Ibérica, pero bueno, las cosas no siempre se consiguen i por suerte de los portugueses, su nación tiene Estado propio con sus leyes i sus cosas, sus más y sus menos, pero sobretodo SIN LOS AGOTADORES PARANOICOPLASTAS NACIONALISTAS ESPAÑOLES.

    Qué envidia me das Braulio, salut i que visca la PENINSULA IBERICA.

  301. Viurelliure:

    Hispania sin Portugal está coja, de alguna manera. Nos hemos quedado sólo en España, pero somos muchos en ES y en POR los que estamos por la unión, si no política, al menos cultural y económica.

    Tal vez en el futuro seamos Iberia.

  302. Con Iberia tendríamos un marco incomparable para solucionar grandes conflictos que se vienen arrastrando desde hace décadas.

    Naturalmente y pensando en CAT, yo personalmente apuesto por esa unión.
    Parece que estamos de acuerdo?

  303. Viurelliure:


    Pues tal vez s’i, aunque tal vez no.

    T’u estar’ias conforme con la uni’on de Arag’on, Castilla, Andaluc’ia, Portugal, Vasconia, Catalunlla, Canarias… en la gran Iberia, sin embargo yo estar’ia por la uni’on de ES y POR en la gran Iberia. Me parece que estamos de acuerdo, pero menys.

  304. De totes maneres les opinions portugueses a youtube són bastant negatives, tampoc són tontos i saben de quin peu calça el nacionalisme fagocitador espanyol…
    No m’extranya que sospitin, amb gent com tu que bateja la unió com a Gran Iberia… realment fa una mica de pudor a reconquista española “liberal-fascista”.

    En fi, estic fart de la teva teranyina, no tornaré a caure en aquest parany, a casa teva l’ambient és violent, està carregat i costa respirar, que la salut t’aguanti molts anys per seguir disfrutant de la teva dosi diaria d’odi.

    Quan estiguis aborrit sincera’t amb les reflexions que et vaig proposar el primer dia…

    “Perquè un dia les cultures oprimides respirin la llibertat.”

  305. Sento pena per tu, com sento pena per la gent que diu que una obra surrealista la pot fer un nen. Només és una gran manca de cultura.

    Les llengües del món són un bé a preservar i si tu no les pots diferenciar de la política o del teu odi visceral pels catalans, tens un problema cultural. Llegeix nano, llegeix i obre els teus petits límits. Sento tristesa per tu i per la teva pobresa d’esperit.

  306. Viurelliure:

    Oh, qu’e pesadez y qu’e estupidez esa de las culturas oprimidas… D’iselo a Roures, por favor. Que invierta su sucio dinero ganado a base de favorecer a los naZionalistas y a ZP, que invierta ese dinero en productos culturales catalanes y que nos deje en paz.

    De qu’e conho de cultura oprimida hablas?

    Lou Lou:

    Chico, pues que te siga dando pena. A m’i tambi’en me dan pena Montilla y Carod y Pujol y Mas y Joel Joan y companh’ia; bueno, m’as que pena, me dan asco, pero eso no tiene importancia.

  307. En Cataluña no existe ningún problema lingüístico, es un tema que desde fuera de Cataluña agitan determinados medios de comunicación de extrema derecha, no para cambiar nada en Cataluña, sino para engañar a los que viven en Castilla o Andalucía, que desconocen la realidad de la sociedad catalana, y obtener su voto o aumentar los beneficios de sus periódicos o radios.

    Desde la Constitución de 1978 se llevan 30 años aplicando en Cataluña las mismas políticas lingüísticas, que han logrado que 3/4 partes de los ciudadanos catalanes sean bilingües y sepan hablar tanto castellano como catalán, y que en otros 30 años prácticamente el 100% lo sea. Políticas similares a las llevadas a cabo en Galicia, Valencia o Baleares por Gobiernos autonómicos del PSOE o del PP.

    En Cataluña, según el Art. 3.2 de la Constitución, son oficiales el castellano y el catalán, los dos. Hay que recordar que el 100% de los ciudadanos catalanes saben hablar en castellano, que es una lengua de fuerte implantación y fuerza, tanto en España como, afortunadamente, en todo el mundo. Y que la lengua que en Cataluña necesita protección, según el Art. 3.3 de la Constitución y por circunstancias históricas y de implantación, es el catalán. El 98% de los periódicos que se venden o de películas que se ven en los cines en Cataluña son en castellano. Cualquiera que vaya a Cataluña puede ver que el castellano no corre ningún peligro allí ni de lejos, y la normalidad con la que los ciudadanos pasan de una lengua a otra sin ningún problema. Allí nadie vive como un problema el hecho de tener dos lenguas, ni siquiera los ciudadanos de origen castellano, de los que tengo varios amigos y familiares.

    En cuanto a las políticas de las Administraciones al respecto hay dos temas importantes, educación y acceso a la función pública, que son las más utilizados para manipular a los ciudadanos de fuera de Cataluña.

    El sistema actual, y vigente hace décadas, garantiza que al acabar la enseñanza todos los alumnos dominen las dos lenguas.
    Existe la posibilidad contemplada legalmente y que se aplica en las solicitudes de matrícula de cursar los estudios sólo en castellano, con una asignatura de catalán. De un millón cien mil alumnos del sistema educativo catalán, entre 30 y 70 alumnos solicitan al año esta posibilidad, fundamentalmente hijos de ciudadanos que se desplazan temporalmente por motivos de trabajo, que lo solicitan porque no van a quedarse. Y un señor que se niega en redondo a que sus hijos aprendan catalán, sólo castellano e inglés, y que es al que sacan a pasear ciertos medios de comunicación como ejemplo de lo que pasa en Cataluña, obviando al millón cien mil restantes. ¿Qué pensarían de alguien que en Madrid no quisiera que sus hijos aprendieran castellano?
    Los ciudadanos que viven en Cataluña que no quieren que sus hijos aprendan catalán y castellano son los mismos que en Madrid no quieren que sus hijos aprendan castellano: ninguno.
    Porque en Cataluña son oficiales las dos lenguas, los alumnos aprenden las dos, no una u otra.
    No se puede pretender que en Cataluña los alumnos no aprendan catalán, además de castellano. La alternativa es una barbaridad, crear un sistema dual, uno para los castellanohablantes y otro para los catalanohablantes, separados, y crear dos sociedades partidas, en lugar de una sociedad integrada, plural y bilingüe.
    Y puede que para lograr esto sea necesario dar cierta preeminencia a la lengua débil socialmente, porque el castellano también se enseña en las escuelas catalanas, y que nadie se preocupe, que no lo van a perder, porque no les interesa, todos los niños catalanes, todos, incluso los de familias catalanohablantes, a los 10 años hablan castellano sin problemas.

    Acceso a la función pública.
    Uno de los argumentos más manidos para atacar las políticas lingüísticas en las Comunidades bilingües es la imposibilidad por parte de los ciudadanos de otras partes de España de trabajar en la Administración allí, por ser algo injusto y limitativo de la libertad.
    Hay que volver a recordar el Art. 3.2 de la Constitución que dice que el catalán es lengua oficial en Cataluña. Que el derecho y la libertad de hablar la lengua que les parezca la tienen los ciudadanos, no el funcionario que está a su servicio.
    Si un ciudadano va a una ventanilla de la Administración tiene derecho a ser atendido si habla en castellano, como así ocurre, por que todos los funcionarios lo hablan. Pero si un ciudadano va a una ventanilla de la Administración también tiene derecho a ser atendido si habla en catalán, lengua oficial en Cataluña, por lo que el funcionario tiene que hablarlo, y es lógico que se exija que así sea.
    No se puede pretender que tenga que venir otro funcionario, cuando además 3/4 partes de los ciudadanos catalanes son bilingües y puede haber un funcionario bilingüe, que atienda tanto en castellano como en catalán. Ni se puede pretender obligar al ciudadano a no hablar una lengua que es oficial allí, somos los ciudadanos los que libremente podemos hablar la lengua que nos parezca cuando nos dirigimos a la Administración, ¿quién aceptaría que le dijesen la lengua en la que tiene que hablar, en Madrid o en Barcelona? Y así ocurre en Cataluña, cada uno habla la que le parece en cada momento en la calle, en la empresa, etc., pero precisamente para garantizar esta libertad, si eres funcionario tienes que ser capaz de atender a todos, y si quieres ser funcionario al servicio de los ciudadanos en Cataluña es lógico que se te exija saber catalán. Y de la escuela tienes que salir hablando los dos. Luego habla libremente el que quieras.

    En definitiva, es una pena que después de 30 años de democracia y Constitución todavía haya tanta gente que se deje engañar con la idea de que España es un país con una sola lengua, que encima está en peligro de desaparición en ciertos sitios, básicamente donde no gobierna el PP.
    La realidad de España, recogida en la Constitución, es que España es un país con varias lenguas, así ha sido, y así será, aunque todavía haya quien piense que los catalanes hablan catalán para joder a los demás.

  308. Madrilenho castellano:

    Gracias por tu comentario tan bien hilvanado.

    Bueno, pues, primero decirte que es curioso que te denomines madrilenho castellano; es como llamarse albino blanco o negro oscuro, en fin.

    Y s’i, s’i hay problema de imposici’on del catal’an en Catalunlla.


    Si Catalunlla es biling~ue todo lo oficial tendr’ia que ser en los dos idiomas: Educaci’on, letreros, justicia, senhalizaciones, etc. Eso no es as’i, s’olo en los centros oficiales dependientes del Estado se cumple el biling~uismo.

    Yo, como ciudadano espanhol no tengo por qu’e ser discriminado a la hora de ejercer mi profesi’on en ninguna instituci’on p’ublica. La lengua de la administraci’on tendr’ia que ser el castellano en todas las administraciones de todas las comunidades aut’onomas, y en cuanto al servicio al p’ublico, debe de haber siempre alguien que hable la lengua regional cuando el ciudadano no pueda o no quiera expresarse en la lengua de todos.

    Todas los gobiernos auton’omicos catalanes han incumplido los mandatos del Tribunal Supremo de Catalunlla que obligaba a que se diese la oportunidad a los padres de elegir la lengua de ensenhanza de la educaci’on primaria. Lo que me cuentas de que s’olo unos miles quieren la educaci’on en castellano es sencillamente FALSO.

    As’i que no me cuentes historias que cada vez somos m’as los que sabemos la verdad. Lo malo es que la gente est’a empezando a ponerse nerviosa y va a decir basta a la manera de los naZionalistas: Con la discriminaci’on y al final con la violencia.

    Ya no conozco a gente del resto de Espanha a los que les caiga bien los catalanes en general, y much’isimo menos los vascos. Luego en el cuerpo a cuerpo y cara a cara la cosa cambia, pero la realidad es que la gente ya no piensa de los catalanes como gente industriosa, liberal y de la que se aprende, sino todo lo contrario, piensa que los catalanes son m’as que antip’aticos, insoportables, y no van m’as que a expoliar al resto de los espanholes.

    Por ‘ultimo, madrilenho, qu’e tragaderas las tuyas, guapo, las tienes m’as grandes que la albondiguilla de la Mar’ia Antonia Iglesias.

  309. Ayer vi como policías de los Mossos d´Esquadra entraban violentamente en un patio de una escuela pública en Barcelona. Ayer vi como arrestaban con una simple identificación acústica a decenas de niños castellanohablantes que estaban jugando al balón y, sin mediar palabra, los introducían en furgones blindados destino a la estación de Sants. Allí vi como los cargaban en sucios vagones de ganado junto a otros centenares de niños que ya se encontraban en su interior, sin agua y sin comida, mientras rápidamente el tren empezaba su inexorable marcha. También vi como algunos niños, los más valientes -o los más inconscientes- se lanzaban desesperados desde unas pequeñas ventanas hacia el exterior rebotando y despedazándose contra los andenes. Los que sobrevivían eran alcanzados por ráfagas de metralleta por los Mossos, pintando con sus pequeños cuerpos una macabra alfombra roja paralela al tren.

    Después de un par de horas de insufribles escenas vi como ese tren llegaba directamente a una especie de nave industrial, fantasmal y abandonada, que parecía estar situada cerca de la montaña de Montserrat, en el corazón de Cataluña; allí donde el alma nacional catalana late estúpidamente en su ciega pasión.

    Ayer vi a los Mossos d´Esquadra obligar a los niños a bajar con su mirada perdida de los vagones del tren, desnudarlos, afeitarles la cabeza y marcarlos -al igual que en una res- un número de identificación en sus brazos. Ayer vi como supuraban sus llagas, como se abrian sus carnes. Ayer vi como a centenares de niños ataviados con camisas y pantalones a rayas les quitaban su nombre y su dignidad. Ayer vi como su infancia bañada en lágrimas dejó, a partir de ese instante, de existir. Ayer descubrí hasta dónde es capaz de llegar el ser humano con su brutalidad.

    El recinto hablaba por sí solo: de las ventanas de las naves salían Mossos para contemplar el espectáculo de los niños maniatados que en silencio eran trasladados en fila hacia unos pequeños y apestosos barracones. Me impresionó como algunos evitaban la mirada de sus carceleros esperando su compasión; me impresionó ver como algunos niños se lanzaban desesperados contra los alambres que vallaban el campo de exterminio, quedando atrapados como moscas en telas de arañas, electrocutados por los más de 5.000 voltios que los electrificaban. Inmóvil e impávido vi como algunos Mossos apostados en las torres del campo les disparaban -sin cesar y locos de poder- descargando su munición sobre ellos, reventando sus cuerpos ya sin vida, destrozándolos. Siendo ya sólo figuras humeantes.

    El resto, y ya dentro de los barracones, esperaban en silencio y sin saberlo su muerte. Al caer la noche fueron llevados sin piedad, uno por uno, a las cámaras de gas. Allí les quitaron su último aliento de vida, su última bocanada de inocencia. Estallaron sus pulmones y dejaron de llorar; para siempre.
    Sus despojos, sus cuerpos ya inertes, fueron sistemáticamente enviados a unos inmensos hornos crematorios, y a lo largo de toda la noche unas altas chimeneas espectrales se encargaron de vomitar gases y cenizas sembrando de sinrazón y muerte todos los pueblos y ciudades de Cataluña.
    Ayer nadie en mi país sonrió, pero tampoco nadie alzó la voz. Ayer el hedor a gases y carne quemada impregnó hasta el último rincón habitable de mi tierra, pero nadie lo denunció; ayer nadie en Cataluña durmió sin dejar de ser cómplice con su silencio; ayer en mi país nadie dejó de ser más que un miserable asesino.

    Como yo. Por omisión del valor. Por mi cobardía.

    A partir de ahora nunca más volveré a dudar de esos historiadores que hace tiempo ya lo advierten, de esos periodistas que ya hace tiempo lo aseguran, de esos investigadores implacables que incesantemente lo denuncian. Jamás les hemos hecho caso y nunca les hemos dado el más mínimo pábulo de credibilidad. Todos pensábamos que equiparar Cataluña a un régimen Nacional-socialista (CataNazi -como algunos la denominan-) y compararla a una tierra en donde se conculcan las libertades individuales y sociales era simplemente una malvada invención y una miserable desmesura; una vulgar locura de unos hijos de puta que odian y desprecian la cultura catalana; una execrable infamia de unos energúmenos que no entienden que defendamos, sin más, nuestra lengua y la pluralidad de este estado. En fin, por pensar que detrás de su revisionismo histórico manco de pluralidad y veracidad en sus razonamientos no existe más que un patético lucro económico a costa de recalcitrantes e ignorantes fascistas ávidos por rememorar su anhelado y antiguo régimen.

    Irremediablemente no los valoramos. Sólo creíamos que era una vil excusa, una planeada exageración. Y resulta que tienen razón, que Cataluña no es más que un proyecto nacionalista de exterminio. Ahora sí, desolado y con mi corazón destrozado, acepto que nos comparen con regímenes totalitarios.

    Ayer me sentía catalán. Hoy ya no.

  310. Pedro:

    Me has logrado poner los pelos de punta… Es la mejor descripci’on de la Catalunlla del tripartito que he podido leer hasta ahora.

    (Anda, exagerao, dir’an algunos)

    Bueno, vale, de acuerdo. Mirad aqu’i y hablamos:




    Chico, qu’e nombre m’as po’etico…

    Al final se te ha olvidado visquear a la Moreneta. Tus amiguitos separatistas no te lo van a perdonar.

  313. He estado echándole un vistazo a tu blog. No está nada mal la crítica al nacionalismo, pero reconóceme que ni España es el mejor país del mundo ni tiene el mejor sistema del mundo, vamos, ni por asomo: en Dinamarca se vive mucho mejor.
    Tu discurso me recuerda un tanto a un partido al principio muy seguido, y después, muy odiado que adquirió protagonismo poco antes del inicio de la II República Española. Me estoy refiriendo al Partido Radical de Alejandro Lerroux. Un discurso con tanta demagogía, anticatalanismo y a su vez, españolismo no podía referirse a otro partido de esa época.
    Tengo bastantes preguntas y una de ellas es: ¿Cómo es posible que definas tan bien los naZionalismos, y que sin embargo excluyas al españolismo de esa calificación?
    El defender a España también es nacionalismo, en este caso no es centrífugo sino centrípeto, pero no deja de ser un nacionalismo más.
    Una vez dicho esto, ¿Consideras que el nacionalismo español debería ser ninguneado de la misma forma en que tú ninguneas a los nacionalismos vasco y catalán?

    Seamos coherentes: no podemos tachar a nadie de nacionalista y darle una connotación negativa a la palabra cuando somos los primeros en defenderlo.

    No creo que sea muy acertado todo el movimiento nacionalista catalán ni vasco, pero en mi opinión merecen un respeto. Al igual que el español también lo merece.
    El que se quiera sentir español y defender la cultura de España, que la defienda, y el que se quiera sentir catalán o vasco y defender la cultura con la que se identifica, que lo haga también. ¿O esta no es una nación libre?

    Sin pararme más tiempo a profundizar, lo que intento decir es que el problema no son los nacionalismos en sí, sino el extremo hasta el que llegan a radicalizarse.
    Todo esto lo digo desde una perspectiva externa a todo nacionalismo ya que pienso sinceramente que tanto me podía haber tocado nacer aquí como en Francia, Bolívia, China o Angola. Y no por eso he de despreciar a la gente que, como yo, tampoco escogió nacer donde nació.

  314. Buenas noches mi amor hacia dias que no podia visitarte pero veo que he llegado en buen momento, primero a Pedro le dire que no se preocupe que sus visiones las tenia Santa Teresa de Jesus y otros muchos esquizofrenicos, que incluso de tanto creer en algo les salian llagas en los pies y las manos, lo segundo mi hija hace 2º de magisterio infantil, y da clases extrescolares a niños con problemas de matematicas, lengua Castellana y Catalana , que ningun niño tiene ningun problema (por regla general en la escuela, que los padres no sean normales, cosa que ocurre amenudo, no es culpa del Catalan) tiene libertad de cuando un niño no entiende algo y pregunta contestarle en el idioma que vea que el niño la va a entender, su problema es que no habla Arabe, ella habla correctamente Catalan Castellano y tiene un alto nivel de ingles al igual que le importa poco dar una clase en Catalan que en Castellano, siempre contesta en el idioma que le preguntan (en arabe por desgracia no puede)en su universidad cada profesor da las clases como cree mejor es mas los libros que compramos da igual el idioma y en que idioma haga el trabajo siempre y cuando el profesor no exija un idioma determinado, a leido libros en Catalan y el trabajo lo ha realizado en Castellano y viceversa, concive que igual que a mi me enseñaron latin cuantas mas lenguas latinas conozcamos mas facil nos sera aprender otras, eso de la lengua materna es una estupidez ya que la lengua materna de mi hija era Catalan y la mia Castellano ella hablo las 2 lengus al unisonio ya que tanto estaba con sus abuelos como con sus padres , no hay nayor estupidez que defender una causa perdida, en Cataluña se habla Catalan porque es la lengua natural, pero ojo ¿tu en Inglaterra que hablas? el mandarin, no es que seais obcecados es que no sois personas libres sois vosotros los que pretendeis invadir una tierra y imponer un idima que es tan Español como el Castellano, cuando Hablais de Español mintiis vilmente, como hipocritas que sois, todos los idiomas hablados en España son Españoles manque os pese, el Castellano proviene de Castilla, es su origen y no es correcto llamarlo Español si no Castellano igual que el gallego es un idioma Español que se habla en otra region, porque a vosotros os sea mas comodo o seais mas facistas, no vamos a cambiar y exijimos respeto porque si yo empizo con fantasias como Pedro tal vez no se te pomgan los pelos de punta si no que habras de depilartelos, desde luego, solo el decir que el Catalan es una mierda demiestra la clase de ultra que sois, que os vaya bonito, pero pensad que en Cataluña la inmensa mayoria de inmigrantes se sienten integrados y pasan de las estupideces que deciis, al contrario, cuando oyen hablar mal de su tierra de acogida la mayoria la defiende, o sea que suerte pero mal lo teneis

  315. Ayer vi a un gilipollas diciendo gilipolleces. Ayer vi a un idiota que se habia fumado un porro y le habia sentado mal. Ayer vi a un colgao que escribía con toda la mala leche del mundo. Idiota, que eres un idiota absoluto. ¿ qué estás hablando imbecil?. Aquí en Barcelona cada uno habla lo que le sale de las narices. Lo menos importante es el castellano o el catalán. Aquí se habla hindú, sanscrito, árabe, aleman, inglés, francés, ruso, chino, japonés. Aquí vive gente de todo el mundo ( no viven en Castilla o en Andalucia o en Asturias). Vienen aquí, a cataluña.
    ( y no soy catalán, ojo). No malmetas idiota de mierda. Fuma costo del bueno y tira esa mierda a la basura.

  316. VISCA CATALUNYA LLIURE ah! perdon lo traduciré a los ignorantes monolinguistas que tampoco saben inglés ni nada


  317. ¿Quién eres tú para conminarme a abandonar mi país, gilipollas? Tu nocomentario al Cubo de la basura.

  318. Tu comentarete al Cubito de la basura.

  319. ¡Ahhhhhhhhhhhhhhhhhhhhhhhh, qué cansinos sois! Otra vez al Cubete de la basura.

  320. hola sóc jo, el gran capullo gilipolles, quina merda que et sobresurt dels teus dintres fatxa merdós, m’agradaria que tot t’aprofités com els perdigons a les guallares…..

  321. sinblancaporelmundo es un buen nombre para un hipócrita niño de papá…

    besitos mi ninito de 35 anos y toma diez euros para que recargues el móvil y puedas llamar a mamá….

  322. Mira macu, si parlem de merda, tindriam que parlar de tú… aixi qe no parlis tan.:)

  323. bueno, la veritat esque el català de merda no en te res eh! Perque visca el català i visca catalunya chaval! (L) De que vas imbecil? de veritat te creus imoportan? O númes esque tens ganes de tocar els huvaris eh! Idota, ia revaras per altra gen..:)

  324. Hola, putu faxa de merda. Nen mal criat, que en te puta vida te han esplicat la de persones que van morir per tan merda escoria com tu. Te esplicare que de fills de puta com tu, ni han molts pel mon, pero que el mes gran fill de puta, el teniu en el valle de los caidos, i que si pudreixi per molt temps, i per ultim, dirte que tu ti asemblas mol.

  325. Bones, passava per aki i m’he entretingut a llegir una estoneta, lol, com pot ser… ús ompliu la boca amb arguments de bar adornats amb una bona parrafada.
    Ús podria recomanar alguna lectura però passo sé que no les llegirieu, el que més m’extranya es que per la manera de parlar sembla que cultureta en tingeu!
    Bé sens més, jo sóc catala i catalanista

  326. Sin blanca:
    Si a tu padre lo hubieran perseguido por ser catalán, tener que pasarte un tiempo en campos de concentración franceses i al volver a tu querida tierra, te encierran en una prisión, para luego pasar-te una larga temporada en batallones de trabajo. Todo esto con 17 años de edad.
    Luego me leo el contenido de tu blog. Y pienso que tu tienes algún trauma infantil. Por que el nacionalismo no es un problema de idioma, sino de pensamiento. Por mucho que a un catalán le hicieran hablar el español en el pasado, sus sueños continuaban siendo en catalán.

  327. Jo,


  328. este blog es una mierda, antes lo leia todos los dias.

  329. com has encés a tots auqests catalanets de pacoltilla, n’hi ha alguns que no saben escriure n’hi amb el seu idioma.la proxima guerra no la guanyareu pas, per que tots els moros aniran amb nosaltres,ja els tenim aqui i els i estem ensenyant el català.

  330. Es català es sa millor llengua que pot existir es unica elegant , i interesant i esta una altura superior a voltrus. x AIXO NO LA SA BEU VALORA llentusa nauvunes a nes container

  331. Senyors, visca Catalunya!

  332. mierda gente pueden tener todos los motivos que quieran pero me parece que no deberian criticarse unos a los otros solo porque uno usa un idioma i otro no,
    solo hablen la lengua en que les hablan a ustedes
    si les hablan en castellano respondan en castellano
    si les hablan en catalan respondan en catalan

    no conozco nada de su historia ni sus conflictos, podran decir que me equivoco que puede ser verdad, pero esto solo genera mas conflictos. lo dejo a su criterio

    soy argentino.
    un beso gente chau.

    • tio eso es un “problema nuestro” mejor dicho de los castellanos de españa.
      Las dos lenguas en partes de españa son oficiales de todas formas ese problma a ti no te deberia de importar

  333. Me es indiferente escribir en catalán o castellano; mi familia es dual del todo (materna y paterna, digamos) en este sentido.

    Y hablo y escribo ambos perfectamente; aunque tengo que reconocer que me crispa bastante todo lo que atañe al sentimiento nacionalista actualmente.

    Tanto los catalanes catalanistas como los españoles españolistas de hoy en día que se crispan por la dualidad entre Catalunya y España, en genérico, parece que subsuman sus ‘creencias’ nacionalistas en una cultura más de odio entre ellas que no otra cosa.

    Me refiero a lo que podríamos leer en los primeros capítulos de “Los orígenes del totalitarismo” de Hanna Arendt, en que se analiza lo referente al sentimiento ‘nacional’ y cómo esto muta de forma irrefrenable, hacia un sentimiento de odio.

    De lo que se trata, tanto en un caso como en otro, a mi forma de ver-entender, es que el nacionalismo de uno conlleve ese amor por lo próximo, por lo que atañe a lo tradicional en su cercanía.

    Que esto sea más incluyente o excluyente a nivel de distancia de abarcar más o menos territorio, eso es cosa que no creo que sea de incumbencia mayor que de uno mismo.

    Así pues, seguiré sin entenderlo. El nacionalismo, para mí, es hablar mi lengua materna (el català), pero también mi lengua ‘paterna’ (el castellano), al mismo tiempo que para mí, el nacionalismo es lo que veo y siento cuando miro por la ventana; cuando oigo a mi vecino despertando a su hermano; cuando me voy con los amigos a una montaña cercana a pasar el día.

    ¿Banderas? ¿Anti-bilingüismos? ¿Políticas autistas?

    ¿Y a mí qué me importa eso?


  334. PD: Entiéndase; por el motivo de escribir y hablar ambos a la perfección no se deriva de forma necesaria que tenga que hablar en uno -y- otro idiomas.

    PPD: Otra aclaración sería la de que del poco interés en política, leyes de bilingüismos, obligaciones en supermercados, odio por la radio, desde la política, desde quien sea… no es falta de interés en lo que, según mi opinión, sería ideal. No se trata de pasotismo hacia esto ajeno al hombre que es la política, sino una rabia irresoluble (por la condición del hoy y aquí) hacia lo que dicen que es política, cosa que nada tiene que ver con el origen ‘πολιτικος’ de la palabra. Almenos, eso creo yo.

    Disfruta la vida, eso sí.

  335. Em sento més tibetà que espanyol.
    No és que n’odiï un i n’estimi l’altre, és que l’empatia vers el tibetà m’esdevé molt més intensa comprensiva i propera a mi.

  336. Feliz cumpleaños sin actualizar, sinblanca.

  337. Yo no he elegido ser español. El gobierno central no nos deja escojer, porque no podemos hacer un referendum, si queremos ser independientes. Porque no hacemos un referendum en Catalunya y si sale que queremos ser independientes no nos dejais en paz? Que mal hay en ello? como si Murcia decide que mejor les irá siendo independientes del resto de España. A mi no me importaria. En el fondo, todos seguiremos perteneciendo a Europa y NO se acabaria el mundo ni se hundiria NADA, simplemente cada uno por su lado y a ponernos de acuerdo en los temas comunitarios (Europeos), como hacemos ahora con Francia o Portugal.
    No entiendo esa puñetera mania fascistoide de conservar la integridad nacional? ni integridad ni nada, eso es un invento para seguir chupando del bote y que el burro catalán siga tirando del carro. Cuanto dinero se recauda en Catalunya? y cuanto se reinvierte? y desde cuantos años hace que estamos en la misma situación?

  338. Debe ser un gran honor que para escribir una opinión te responda tanta gente, TANTA, que ya reulta bastante impensable leer todas las opiniones dejadas en esta página. No obstante quiero dejar mi granito de arena sin ánimo de faltar al respeto a nadie.

    Soy una mujer joven, nacida en un pueblo de Catalunya hace prácticamente 22 años, en mi infáncia estaba convencida de que mi país era Catalunya: un país independiente, y se me escapaba llegar a comprender que suponía aquello que nombraban España y que con mucho trabajo lograba situar en un mapa debido a mi corta edad; muchas de las personas que ya han opinado pensarán que esto és una falta del sistema educativo, una educación por parte de mi família sumamente nacionalista (nazionalista como algunos se empeñan a ridiculizar) o simplemente una falta de juicio de mi persona, falta de cultura o simplemente de vivir en un mundo a parte en un pueblo (allí dónde la gente parece ser bárbara y analfabeta en algunas ocasiones). Pues estoy convencida que no: aprendí castellano a los 11 años, por supuesto toda la vida lo he entendido, evidente es que todas las peliculas, la mayoria de los canales de television, publicidad, tiendas, empresas, personalidades diversas hablaban el castellano: ¿QUÉ me permitió a mi vivir durante 11 años de mi vida sin utilizar el castellano? algunos lo verán como una mancha negra en el mapa (un sitio donde la gente que viene de fuera se verá obligada a aprendrer el catalán para vivir y trabajar… yo lo veo como un pueblo donde gente mayoritariamente mayor vive y sobrevive en su propia cultura sin molestar a nadie y sin pretender hundir al gran Estado al que su DNI dice que pertenecen. Se trata de una necesidad colectiva humana la de mantener viva la propia cultura pero siempre gana la cultura mas fuerte sobre la debil. és verdad que las culturas no se pueden mantener intactas al paso del tiempo, pero es que no ha sufrido bastantes cambios la cultura catalana a lo largo del tiempo? pq se tiene que ver frustrada a que al minimo paso que lleve a cabo por tal de asegurar la vida própia d la cultura sea su gente catalogada de nazi?

    Un chico jóven nacido en Cataluña y que no habla ni una sola palabra de catalán me dijo un día que el catalán era una lengua muy antigua y que hablaba muy poca gente… pues que se muera, total, el español és una lengua rica y colonizadora, que derecho tienen estos cuatro pesados a exigir una protección a su propia cultura? No lucharon los españoles para no perder sus propas colonias cuando vieron que esto suponía una perdida de dominio cultural y por supuesto económico de su própia nación…?

    Ahora que me he hecho mayor y la vida me a llevado a conocer un poco de mundo me doy cuenta de q en las ciudades todo el mundo habla castellano, que la gente se autoconvence de que el catalan no sirve de nada y que todas las voces que provienen del estado les llaman naZionalistas por pretender hacer clases en catalán, institucionalizar la lengua a sus máximos estadios, los niños cada vez habñlan peor el catalán y se rien de mi por hablarlo correctamente, hay alguien que me diceque hablo catalán guarro, ¿pues esto es lo que soy? No hay culturas mejores y peores, pero si hay culturas débiles y culturas fuertes, que nos dejen a los catalenes proteger nuestra propia cultura pq si no lo hacemos nosotros nadie lño hará por nosotro, y la realida del que considero mi país ya está bastante dañada como para tener que escuchar según que cosas. Hoy en día salgo por la calle de mi pueblo y totdo el mundo habla en castellano, en solo 10 años el catalán empieza a ser una minoría en el que era un pueblodónde todo el mundo se consideraba catalán y la lengua que se hablaba era el catalán: DENTRO DE 10 AÑOS ME IMAGINO EL CATALÁN COMO UNA LENGUA QUE ALGUNOS PADRES ENSEÑAN A SUS HIJOS ¨DICIENDOLES QUE ESTO ERA LO QUE HABLABAN SUS PADRES; ENTONCES ALGUNO QUE HAORA CRITICA TANTO SE SENTIRÁ MUY FELÍZ (QUIÉN SERÄ ENTONCERS EL SELECCIONADOR TAL Y CÓMO HACÍAN LOS NACIS?

    He escrito en castellano q creo que la gente a la que va dirigido este escrito pude que no entienda mi unica lenga materna, para mi escribir en inglés tiene la isma función, y estoy satisfecha por ello, poder enteder hablar y escribir en 4 o 5 idiomas tan solo es una muestra de nivel cultural, a lo mejor se me ocurre aprender suajili aunque no sea la lengua oficial de ningún imperio todopoderoso.

    • Gracias por tu extenso comentario en mi bitácora.

      No sé de qué pueblo de Cataluña me hablas, por lo tanto no te puedo rebatir tus comentarios sobre un pueblo del interior de Cataluña que hace sólo unos diez años era prácticamente sólo catalanohablante y ahora está prácticamente inundado por gente de habla castellana. ¿De dónde? ¿No creo que sean de otras partes de España porque ya los otros españoles no emigran a Cataluña? A lo mejor son extranjeros que eligen el español para comunicarse entre ellos.. estoy especulando, no tengo ni idea porqué será.

      Dejando de lado muchos temas sólo te voy a hablar de uno o mejor dicho de dos:

      Primero: Si Cataluña es oficialmente bilingüe quiero que todo lo OFICIAL sea bilingüe. La educación, la sanidad, las señalizaciones, etc. Si tú en tu casa a tus hijos hasta los once o hasta los ochenta les quieres hablar sólo en catalán es tu opción eres libre.

      Segundo: Yo, como español que vive fuera de Cataluña tengo los mismos derechos que tú en Cataluña, como tú los tendrías aquí, en Valencia donde ahora vivo yo, por ejemplo. En resumen, quiero igualdad de derechos y deberes entre españoles.

      Un abrazo y pásatelo bien, guapa.

  339. Si el referendum se hiciera y saliera negativo a la independencia no daría nunca mas derecho a Catalunya a pedirla, y nos condenaría aún mas a la ridiculizacion… por supuesto saldría negativa pq los empresarios y gente poderosa son siempre conservadores ante los cambios.

  340. Yo creo que es fundamental en una sociedad moderna proteger y amparar el uso de una lengua como el catalán, el euskera o el gallego. Estoy a favor de que se hable y/o escriba donde sea, cuando sea y como sea; de que se traduzca y doble toda la producción cultural posible a la lengua correspondiente y de que se promueva su uso… Pero tengo que poner una excepción. Aunque no tengo NINGUNA experiencia personal de discriminación lingüística (que quede bien claro), creo que sería justo exigir que cualquier texto (elegir la lengua en la que se educan los hijos, estudios universitarios y bachilleratos, oposiciones, rótulos, señales de tráfico, etc…) esté disponible en castellano (que es el idioma común a todos los españoles, para bien o para mal… XD) y que si se le pide a alguien amablemente comunicarse en castellano (por desconocimiento de la lengua natural del entorno) se le responda en éste. Lo cierto es que desconozco si esto funciona así de bien en Cataluña, Galicia o Euskadi. Si es así, LO CELEBRO, porque significa que somos (posiblemente) la sociedad más avanzada del mundo; si no es así, espero que cambie pronto, porque me parecería injusto. Cuando veo textos en catalán (por ejemplo), intento comprender lo que dicen, aprender algo (creo que siempre viene bien aprender cosas); pero tembién es cierto que a veces he visto a alguien (POCAS veces, que quede claro) escribir en algunos sitios en otras lenguas sólo con ánimo de NO ser entendido (y eso sienta un poco mal, todo sea dicho).
    En resumen: Un poco más de BUENA INTENCIÓN y un poco menos de PREJUICIOS.

  341. Doncs jo també hi tiraré una carta…
    Si, és divertit, i realment entre tots ja l’hem omplert força!
    Ell no ens entendrà mai, però tot hi així no defalliu companys!
    Que no estripa les cartes, se les penja al plafó en forma de col.lecció!

    Avui passejant el gos he pensat en tu, i t’ho explico perquè vegis que no et tinc recança, el gos se’t pixava als peus i te l’he fet fora d’una estrebada!
    Però és que no sé pas què hi fots plantat com un estaquirot a la plaça del poble vestit de bústia de correos del indivisible imperio común que es el español.

  342. que verguenza me da ser del mismo pais que el tuyo.
    Debes ser un chavalin, pork normalmente esto de los nacionalismos llega a los 15 y se va por los 18 jaja.
    Me demuestras que tus horizontes son proximos y pequeños. jajaj
    no so cansais contestando y debatiendo, pues este tema no lleva a conclusiones (a parte de avergonzar a terceros)
    Todos nos convertiremos en polvo, y para mi, lo de menos es saber en que pais pertenezco.

  343. Pues perteneces al Estado Español, Yordi…
    i te dedico un Gora Euskadi! i seguro que gritas Gora!
    i si digo Visca Catalunya!? ui ui que vergüenza…

    La vergonya que sento jo veient el patetisme acomplexat de qui no estima la seva cultura perquè els del cavall de Troia diuen que és lletja.

    Si Jordi, tots ens convertirem en pols, i el teu gran horitzó per Catalunya deu ser un electrograma pla.

  344. capullo de merda, com goses dir que el català és una merda?! vostè sí que és una gran merda com poques se n’han fet.
    Ton pare et devia alimentar de polles per arribar a ser una persoa tan puta com per escriure això!!
    Sense anomenar ta avia, que n’era un altre com tu, una punyatera faxista de extrema dreta que s’elimentava de mentides ideologiques, que anomenarem “Pollas”.

    • estic totalment d’acord amb en cony. Se avia el devia d’alimentar a base de “pollas” descomunals.
      M’agriadaria mencionar també una cosa que s’hadeixat de dir el cony i és que li hauries de dir a ta mare que rebaixés els preus ja que les “feines” que m´ha fet no han sigut pas les millors que he rebut.
      Pensant-hi bé dient les cosees que has dit no crec que puguis haver nascut de manera normal; de ben segur que et deurien haver cagat en lloc de parit!


    • Bueno, tu i el Penis sou la parella perfecta. Quina creu, Déu meu!

  345. pero como osais desir esto, putonaziocomunistacatalanes!!!
    os voi a partir la cara de catalanes que teneis. me voi a limpiar el culo con vuestras lenguaas de catalanistas. me cago en vuestro put puevlol ascerosos polacos.

    Biba España!!!!

  346. ¿habeis dicho mierda?
    Por mierda la que vendo yo que es de lo mejor Y con los mejores precios.( pastillas, coca, maria, chocolate, cannabis,etc.)
    si estais inteeresados respondedme

    PD:yo no me hago responsable de lo que pase con lo que venda

  347. en resum penso que la opinió que té sobre el català és totalment errònia i de retruc penso que vostè sí que és una puta meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeRDAAAAAAAAAAAAAAAA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  348. No comparto tú opinión.
    Y el artículo no es más que una opinión personal, tampoco es tema de debate.

  349. El catalan es una puta mierda¿? …tampoco es eso

    El catalán es el catalán Los catalanes son los catalanes y los catalanistas son los catalanistas
    “Nos arrullan con cuentos” El cuanto delos catalanistas es: “Somos un araza superior ( los catalanes) Invadidos y explotados por una raza inferior ( los españoles)” y esa es su versión simplificada d e la historia d e España Cataluña incluida ¿Es absurdo Si pero esta estupidez tiene su publico Como cualquier estupidez en la qu eunso e gaste un Dinero

    Distigamso La Lengua Catalna Una engu avale exactamente el numero de sus hablantes La mas importante el Chino la segunda el Ingles y la tercera el Español ( aqui provincianmente conocido como castellano) El lugar de la lengu actalana en el mundo es el que le corresponde y NO otro Otra cosa son als pajas mentale ssubjetivas que se haga cada cual ( con el ctalan con el servocroata o con el chino o con el arabe-esta ultima segun el coran la lengua con la que dios se dirige a lso angeles Ahi es ná!!! Tambien lso ahy que dira que dios es catal y del Barsa pero ¿ aquien le simporta ese tipo de gentecilla?
    Distingamos aquí entre ctalanes y “clase dirigente catalana” La clase dirigente catalana siempre ha jugado al victimismo Es la manera d efomenetar el odio entre poblaciones para …forrarse
    Ahora nadie se acuerda de cómo se separo Portugal de Castilla pero conviene recordarlo porque NO OS LO CUENTA NADIE y lo que pasa ahora es exactamente LO MISMO

    El rey de catill al eentrego un condado a un noble Borgoñon casado con princesa castellana en la frontera de la reconquista. El hijo del Borgoñon no contento con lo qu etiene se le antoja ser rey Su propia madre s e opone a ello por las armas y es derrotada en batalla Pero ¿Qué hace el rey de castilla? Pues nada el muy GILIPOLLAS decia qu eno le importaba que el borgoñon se hiciera rey porque el lo qu equeria ser era Emperador y necesitaba reyes a su servicio ¿S epuede ser mas gilipollas? ( la historia y anso ha demsotardo que si que se puede) pero sigamos Por este desinteres del rey de castilla se forma el reino de Portugal Pero claro la frontera es una puta raya en un mapa y el pueblo a mabslados d ela raya es el mismo ¿Cómo soliucionar esto para perpetuar el reyno? Facil propaganda y sembrar el odio Los que estan de este lado de la raya son guays Portugueses los que han quedado del otro son putos castellanos seres odiosos “ Con esta propaganda han mantenido al pueblo portugues separado del resto de españa muchos años Talvez demasiados y esos i pegándonos entre nosotros después de toos esos siglos de propaganda Es increíble que el 30% de los portugueses diga ahora que no le importaría unirse con España

    Ccon Cataluña y con el pais vasco pas alo mismo ahora tenemos otro yellezuleo “inteligente” llamdo Zapatero pero eso es otra historia…

    La clase dirigente Catalna lo que quiere son puestso en propiedad para ellos y para sus hijos Si se separan Todos de embajadores colocados robando y con poder ¿qué ma s pueden pedir?
    Y dilapidaron el legado del reino de Aragón ( el Rosellon lo perdieron antes de la union con Castilla y formar España) y los reinos de Aragón en el Mediterráneo ( sicilia, Córcega Nápoles, Gibraltar, y Menorca- esta ultima recuperada de casualidad-) Iniciaron al guerra de Sucesión contra el resto delos reinos y eso qu eprimero habian jurado al Borbón y luego se cagaron en su propio juramneto…

    Me tengo que ir adios

  350. Quin tros d’ignorant estas fet, no vals ni la merda que cagues. Per començar, jo de tu, em tornaria a llegir els llibres d’hirtòria i si no t’és suficient fotet-els pel cul.

  351. Cony ets el meu ídol tinc les parets de l’habitació plenes de posters teu, i no vegis… Tens tota la raó en el que dius però crec que has estat massa suau. Jo crec que aquest tiu no es distingeix la polla del polze de lo retrasat que és. M’agradaria saber quina edat té com per dir semblants bajanades com ha dit. I una cosa que m’ha ofès molt de les que ha dit és que el català no es mereix tenir parlants, abans que ofendre gent d’aquesta manera asseguis al sofà com deu fer sempre fotent-se palles amb polla madrid. Segur que la guarra puta aquella que sempre insulta els catalans et possa molt amb les seves mentides i farses dient que marginem els espanyols als nostres coles quan la majoria parlen casellà. Que et folli un gos.
    Que tingui un bon dia.

  352. mira fill de mil putas no parlis tan soplapollas que aurias de menjarla millor per començar so escgarrapactistos, aixafallimones, morros de conY! que mes gilipollas i et pareixen de plàstic so puta barat. aviam si algun dia et pilla un camió et deixa mes fet merda de el que ja estas so desgraciat social. i ojalà vagis per barris xungos i et petin el cul fins que suplicis la mort fill de puta.



  353. que todos los que crean qe dios es messi que dejen un comentario con YO.



  354. Bueno… ¿por dónde empiezo?
    Personajillo “sinblancaporelmundo”(o mejor sincerebroporelmundo). Tú tienes problemas personales, lo has dejado bien claro. Tu problema es (aparte de no enterarte de la copla) que tienes rencor por ser imbécil y no entender nada de la transición. Todas estas canciones y muchísimas más, se cantaban en vuestra puta cara. ¿No entendías nada y cantabas por ahí…? jajajaja pobrecito (no das más de sí…)
    No intentaré hacerte comprender lo imbécil que eres, porque se requería toda una vida.
    Pero si te diré, a ti y a todos los imbéciles como tú, que esto es muy sencillo. No nos queréis (solo molestamos), y nosotros tampoco os queremos (No nos sentimos identificados con el estado). Coño…, pues nos separamos y todos contentos (o ¿no?, siempre está el tonto del culo que nada le está bien).
    Por último, si no lo digo…exploto: Chaval eres la última mierda del estercolero, ¡te crees intelectual! Jajajja…, pero si solo sueltas mierda, o debo decir: mierda, pero de calidad.

  355. mira tu eres guilipollas y retrasado mental el catalan es lo mjor de el mundo y mira te ablo castellano para k te enteres de lo guilipollas k eres mira la senyera/els segador i catalunya son las mejores cosas k un pais puede tener!y si creesc k españa y sabes k??con españa me linpio yo el culo guilipollas!!!

  356. VISKA CATALUNYA!!!!!!

  357. Escolteu Castellnas que no estiman a Catalunya:

    Per que no partiu i dexeu que Catalunya estigui sola i pogui prosperar sense la sangria que vosaltres porteu a Catalunya?

    Aneu tots a la Merda!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

    Un Catala de devo:

    Manel Brugat i Orus.

  358. No et farem esperar més… primer pensem idolatrar a “Esteblocesunamierdaysuautorunimbecil” gràcies per dexar-li les coses clares xD i seguidament pensem cremar la teva casa un cop t’aguem localitzat… ( si ´s que en tens) Friki !!! Repelent !! Sensevidasocial !! Follamares !! …….. IMBÈCIL !!

  359. Aixafacítrics jo no se que us passa a tots els faxes que de seguida utilitzeu la paraula follar, polla, sé que sou una mica parguelas, però crec que tu t’emportes el premi cervantes al més maricon i aixafacítrics, (cabróna) a més tinc entès que us agraden bastants grans i negres, be però alla cada un, sent que jo als maricons els respecte, però noi a sobre de maricon també faxa, joder has de ser una benedicció per als teus, fill de puta, gilicolgat.

  360. la puta merda del catala dona fastic ies la mare de puta merda!

  361. Xarrupa cabeça! Punxa el link:

  362. Los catalanes son las personas mas irrespetuosas intolerantes y xenofobas que pude encontrarme en mis viajes por España.

    Mi problema con ellos no se extiende solo a su idioma, francamente si tuvieran una mejor actitud seria mucho mas soportable.

    Quien dice que los catalanes son tolerantes, razonables y pacíficos es que no entiende lo que significa una conversación, una diferencia de opiniones.

    Basta con decir “no me gusta X” como para caldear y agitar a la mayoria, “vete de cataluña si no te gusta” es la respuesta mas normal, no pudiendo aceptar que alguien que viene de afuera no vea la grandesa de sus costumbres milenarias.

    Voy a aprovechar esta respuesta en este articulo, que con suerte quedara grabada por el resto de la eternidad dado el posicionamiento del articulo.

    Quiero que sepan catalanes:

    -Su pan es detestable, Cuesta encontrar una panadería, un “forn de pa” que use buenos materiales, Su tan “original” costumbre de humedecer el pan con tomate solo tiene éxito porque el pan catalan necesita ser ablandado como si estuviésemos en la edad media. Lo mas gracioso es que esta dureza ni siquiera es resultado de métodos tradicionales, porque uno esperaría que una panadería usara los mejores ingredientes, porque se especializa en vender pan, porque etc.
    Nada de eso, nada de levadura real, mas de una panadería catalana vende pan hecho con polvo de hornear, con harina barata y a un precio ridículo.
    Me sorprendí mientras pensaba que el pan no podía ser de peor calidad, cuando ayer mismo el interior de mi barra de pan estaba crudo.

    -“los catalanes inventamos el bikini”. Y los tuppers, porque también parece que viviesen dentro de uno.

    -Xenofobos y racistas, especialmente sus ancianos. Los ancianos catalanes son monstruos disfrazados de pequeños viejitos simpáticos. Dado que soy blanco y rubio se me abrieron mucho y pude escucharlos decirme “mira esos, que se vuelvan a su pais” señalando unos latinoamericanos, graciosamente, yo soy igual de extranjero y no se daban cuenta de a quien le estaban hablando. No hay ninguna justificación posible. Mas cuando no me paso una, si no varias veces, en distintas partes de Cataluña.

    -Propaganda. Dentro de Barcelona es prácticamente imposible pasar un día sin escuchar “Barcelona, catalán, Cataluña” al menos una vez. ¿Les parece normal catalanes?

    -Juventud ignorante, impertinente y en general, monstrousa.
    Los niños catalanes son malcriados y ruidosos. Los jóvenes catalanes son malcriados y ruidosos.
    Me sorprendia mucho la chica que no leia libros y no veia peliculas anteriores al 2000.

  363. los españoles si quee es una mierda idiotas

  364. Es curioso. Con todo lo que ha pasado y despues del “Constutinazo” al estatut de Catalunya, todavía los Castellanos, no entienden, porque Catalunya desea ser independiente de España.

    No nos une un lazo cultural muy común, temeos una Lengua distinta, y un pasado de agravios con españa, ese imperio en el cual nunca se ponía el sol, que creo que es obvio porque queremos separarnos.

    Para tener independencia, lo primero es poder. Esto es tener capacidad industrial y económica para poder subsistir. Si no hay dinero “na de ná”.

    Lo segundo es el convencimiento de porder ser independiente. Y eso tambien lo tenemos.

    Lo tercero es tener esa identidad nacional. Que es Catalunya y que no.

    Lo cuarto es tener claro, que un ves fuera de españa hay que pedir el ingreso en la UE, sino estamos muertos…
    (Y si, para aquellos españolitos que diga que de hecho Catalunya YA esta en la UE, no es lo mismo estar como un País, que cómo un parte de un pais. No jodamos).

    Lo quinto, y no menos importante, es poder defender esa independencia. Especialmente del ejército de la Corona de España, que ya nos lo conocemos.

    Y lo Sexto, articular un gobierno debidamente serio, cómo paractuar como un país.( este reto si tiene tela).

    Que Catalunya lleva tod ala vida implicándose en España es evidente. Y no hace falta hacer un vídeo.

    Si Catalunya perdió sus derechois en 1714, por luchar contra Castilla, por quien debia de ocupar la Corona Española.¿No es eso implicarse con España?, y salimos Escaldaos….

    Despues y lo mas gordo es la Guerra civil. ¿Esque Catalunya Giró la espalda a España?, y no permitió la entrada de todos loso refugiados de España, que Franco perseguia para meterlos en un campo de concentración y después fusilar????, ¿es que no se jugó nada?….

    Desdeluego podriamos haber hecho coómo otras zonas de España que le dieron las congratulaciones a Franco tal como entró, sin luchar, y así seguro ubieramos mantenido más. ¿Pero debia Catalunya no luchar contra el franquismo?

    Tened en cuanta que Aunque franquista, Castilla, Andalucia, Aragón, Valencia, Galicia, Extremadura, y demás continuaron teniendo sus seás de indentidad, celebrando sus fiestas, y exibiendo sus bamderas regionales, y hablando su idioma. (El andalú ze abla mu bié mi arma)..

    Se bailaba en la Verbena de la Paloma en Madrid, que seguía manteniendo el Oso y el Madroño, Los Aragoneses segúian teniendo sus Jotas y sus fiestas, y en definitiva su identidad, y los Valencianos, che,seguían teniendo sus fallas, sus falleras mayores, y su valenciá (dialecto, aunque les joda a los del PP, del Catalán)

    Pero en Catalunya y Pais VAsco, NO, se prohibio la lengua, la bandera, la Sardana(no es que me guste, eh?), els castellers, habalr el catalán estaba prohibido……

    Más de 30 años despues de todo aquello, Los catalanes asistimos estupefactos, a como el gobierno español, permite que unos Jueces Franquistas, continuen ejerciendo, y pongan fuera de su cargo al Garzón, por investigar los crímemes del Franquismo en virtud de la ley de la memoria Histórica.

    Asistimos con verguenza al patético espectaculo de los Falagistas denunciando al Juez (una cosa que en un pais SERIO como Alemania estarian todos en prisión porque el Partido falangista y el aguilucho serian directamente delito)..

    ¿Aun queris saber porque Catalunya no quiere ser parte de España?……¿Lo quereis mas claro?………….

    Joder!, que tropa!

  365. Es muy fácil ver las diferencias con tus vecinos y no ver lo que tienes en común…

    Mas cuando fuiste criado con la idea de que te habían provocado una injusticia, con que te quitaron algo que era tuyo, Etc.

    Pero no me lo creo, cuando ganaron el mundial todos salieron a festejar.
    ¿No es una actitud hipócrita?
    Digo, no quieren ser España pero están para cobrar. No quieren ser España, pero están para festejar por la victoria del mundial.

    Incluso si hubiese gente que no festejo… era tan inferior en cantidad que simplemente no importa, No se veían en ninguna parte. Las calles eran festejo y alegría, la alegría de la victoria. Fue como si por unas horas, toda esa supuestamente fuerte identidad patriótica se hubiese desvanecido en el aire.

    Si quieren separarse de España deberían ponerse de acuerdo, y convencerse, los unos a los otros, en ves de quejarse de los de afuera. Pero nunca van a hacer eso. Porque se darían cuenta de la verdad:

    No saben lo que implica separarse de España, nunca se pusieron a pensarlo.
    No saben realmente que significa ser libre o estar en cautiverio.
    No tienen idea de la situación mundial, no saben donde están parados.
    No saben cuan emparentados con España están.

    • Quan espanya va guanyar el mundial molts ho celebraven perquè la meitat dels jugadors eren catalans i/o del Barça.
      Quan espanya va guanyare el mundial hi havia coches que ho celebraven però quan el Barça va guanyar la lliga no podien circular els cotxes per la quantitat de gent que hi havia ocupant els carrers.

      Catalunya és la comunitat que més paga i menys rep. D’espanya no cobrem res, prou mentides!.

      Molts països s’han separat en els darrers anys i els hi va millor, a nosaltres també ens hi aniria sense pagar tant a espanya i fer-ho directament a Europa.

      Ser lliure, per començar, seria poder parlar en català a tot el món no com ara. Que no podem fer-ho i si ho fem ho hem de fer en una llengua estrangera.

      Etem tan emparentats amb espanya com Portugal.

    • Estem més emparentats amb Andorra.

  366. Lo que sí es una puta mierda es este blog. Decir más sería perder el tiempo.

  367. Cataluña pertenece a España del mismo modo que pertenecia el Sahara y Guinea Española. O sea que a pagar y a callar. Los Impuestos de cataluña para Castilla que gano la gerra !ea!. La educacion y la sanidad que se la pagen o que se jodan. Ya tenia razon Quevedo en que habia de sembrar sal en cataluña i matara atodos los catalanes. !VIVA FRANCO ARRIBA EJPAÑA!

    • Cataluña es de todos los españoles, como cualquier parte de España es de todos los españoles( y asi, de los catalanes).

      Entendiendo esto, los impuestos, ingresos o realidades históricas (inventadas o no), no son relevantes. Para querer separarse van a tener que lograr que todos los demás españoles opinen de la misma manera.

      Suerte con eso.

      • Eso es absolutamente falso. En ningún país que se descolonizó y alcanzó su independencia los ciudadanos de la metropoli votaron.
        Eso sería estúpido. Y así está reconocido en todas las leyes internacionales que la propia españa suscribió.
        Suerte con hacer creer tus mentiras a la gente.

    • Con gente como tu en el poder nacieron grupos armados como eta, grapo, terra lliure, etc. ¿no?

      • >>implicando que cataluña es una colonia y que de alguna manera sufre como sufrieron en algun momento los paises que se descolonizaron.

        Sos un payaso.

    • Bueno, jose antonio, ya sabemos que Catalunya es igual que el Sahara Occidental y la Guinea española y todos los países latinoamericanos. Ya sabemos que somos vuestra colonia desde hace 300 años y también sabemos que nos robáis con los impuestos.

      ¡Por fin un facha dice la verdad sin tapujos coño!

      ¡Ya era hora!

      En fin, ahora, lo que nos falta a los catalanes es lo mismoque han conseguido todas las otras colonias: La libertad y la independencia y poder, así, dejar de hablar con mierdas nostálgicos del fascismo que firman como Jose antonio Primo de Rivera porque serán de otro país diferente y no queremos crear conflictos internacionales.

      • anon en 12 julio, 2011 a las 8:21 am dijo:
        Naturalment, pallasso, Catalunya va sofrir tant o més que qualsevol colònia el 1714 i els anys següents.
        Ara, passats tres-cents anys ja no mateu pels carrers com abans però seguim sent una colònia.
        De la mateixa manera tota Amèrica llatina va sofrir grans pèrdues humanes durant els segles XVI i XVII però al segle XIX, quan es van independitzar,, tamopoc els matàveu pel carrer.
        Per cert, si tú ets sudaca això ja ho hauries de saber, pringat!

  368. je je je je je je je je je …ja jaj ja ja ja ja ja ja ja.hoooooooo! ummmmm! ji ji ji ji ji ji ji ji .
    Venga castellanos otro chiste mas.

  369. mira los catalanes somos los mejores entendido retrasados

  370. Filldeputa!

  371. El tiempo pone las cosas en su sitio y en perspectiva se ven mucho mejor. Nada es perfecto y todo conlleva deficiencias, Cuando en el año 78 , yo tenía 20 años y por tanto he vivido estos episodios, España estaba en pleno meollo de la transición se pactó que para realizar una transición en calma, básicamente 2 comunidades verían reconocidas unas prerrogativas históricas especiales por diferencia identitaria: Euzkadi/Navarra y Cataluña. ¿Por qué? Por un hecho muy sencillo ambas comunidades históricas habían visto mermada siglos atrás su primitivo marco geográfico ya que tanto España como Fancia fraccionaron su unidad identitaria, lingüística y teritorial que abarcaba territorios allende los Pirineos, por puro imperativo centralista de Madrid y París. Reconociendo estos derechos históricos y plasmarlos en unos ESTATUTOS ESPECIALES para ambas comunidades, Madrid se aseguraba su lealtad a España. Una vez transcurridos estos 30 años este pacto no se ha cumplido. Tanto el
    PSOE como el PP, muy especialmente desde que gobernó el Sr. Aznar, al impulsar la consigna de “café para todos” miminizaron muy especialmente estos derechos estatutarios que la Corona quiso otorgar y así han continuado estos últimos años atacando sin cesar a Cataluña. Evidentemente Cataluña ha intentado defenderse contratacando como ha podido. Én plan positivo deberíamos decir que en España no se ha dado un episodio tan cruento como pasó en los Balcanes con Yugoslavia. En plan negativo los episodios de Argentina y Chile donde se llevó a sus respectivos ejércitos hasta la Justicia que se han visto que eran necesarios, aquí no se hizo porque había estos pactos. De esta manera el postfranquismo pudo vivir muy tranquilo pero en cambio el golpe de Tejero en el 82 implicó otra vez el aniquilar poco a poco los derechos históricos reconocidos por la Corona tanto vasco como catalán. Y así estamos pudiendo afirmar en definitiva que la transición española ha llegado a ser verdaderamente una auténtica tomadura de pelo donde el centralismo y el mesetarismo imperan otra vez a sus anchas y ello conlleva una España autoritaria, intransigente y sin futuro para este siglo XXI recien estrenado. Habría que ver las cosas de una manera imparcial, ni España sí tiene que ser el malo de la película ni Cataluña tampoco tiene que ser el bueno de la película. Ambas tiene cosas buenas y malas. Pero los pactos están para cumplirse y el pacto que quiso instaurar la Corona en la transción lamentablemente no se ha llevado a cabo de manera que el futuro en el territorio ibérico de nuevo se presenta muy incierto.

    POST-DATA O EJEMPLO. Cuando yo hablo en catalan con un ciudadano de Perpignan (antigua Catalunya Nord). ¿¿¿Este ciudadano de Perpiñan (Francia) que es catalán de nacimiento, es también español???. Evidentemente no, solamente es francés, por imperativo legal. TANTO EL COMO YO SOMOS Y NOS SENTIMOS CATALANES. Pero él es francés por imperativo legal y yo español por imperativo legal. Y TANTO EL COMO YO EN REALIDAD SOLAMENTE NOS SENTIMOS CATALANES PORQUE PERTENECEMOS A UNA ANTIGUA PATRIA COMUN LLAMADA CATALUNYA Supongo que un vasco o navarro de ambas vertientes pirenaicas deben sentir lo mismo…

    • El PSOE va guanyar les primeres eleccions l’any 1985 i el cop d’estat de Tejero fou el 23F de 1981.
      O sigui que això d’atacar Catalunya ja venia d’abans i el PSOE va governar atacant-la des del principi o millor dit: desde que tots els partits a l’esquerra del PSOE, incloent ERC (a excepció de Catalunya Lliure i Herri Batasuna) van renunciar al dret a l’autodeterminació el mateix 1978.
      Està molt bé no generalitzar ni dir que hi ha bons i dolents, etc. Molt bé però n’hi ha uns que no han complert: els espanyols i els altres sí: els catalans. Per tant, perdona, però no els pots posar a tots al mateix sac. això seria com castigar els innocents i/o premiar els culpables.

      • Potser el PSOE va guanyar les primeres eleccions el 1982. És igual. Fou desprès d’haver renunciat al dret a l’autodeterminació el 1978 i desprès del 23F de 1981.
        A més durant els anys 80 i 90 van crear i finançar els G.A.L. amb guàrdies civils ex-franquistes. Crims pels quals no han pagat, especialment el senyor X que amb una resposta negativa de Felipe González va deixar de buscar-se per part de l’estat hipòcrita espanyol. A no ser que es reconegui que la democràcia espanyola manté la pena de mort. Com quan van aparèixer “casualment” cinc etarres “suicidats” la setmana desprès de la mort de Miquel Àngel Blanco durant el govern del PP.
        El “café para todos” fou un invent d’Alfonso Guerra del PSOE (els “federalistes”). “Café para todos” menys els vascos, és clar.
        En realitat durant el govern Aznar es van aconseguir més pressupostos que amb Felipe González.
        Jo no sóc de dretes ni de CiU però està clar que el PSOE no és d’esquerres i són tant imperialistes el PP com el PSOE.
        L’únic pas endavant que ha fet el PSC per Catalunya fou el passat estatut d’autonomia que, desprès, van pactar d’amagatotis Artur Mas de CiU i ZP de PSOE a Madrid retatllant-lo.
        Desprès de la denúncia conjunta del PP i de Falange Española al TC
        tenim que defensar la llengua vehicular catalana a les escoles com en els temps preconstitucionals amb el greuge que ara no ens defensem d’una dictadura militar feixista sinó d’una democràcia constitucionalista.
        La única forma de no estar a mans de la voluntat d’aquests estrangers que ens denigren i no oculten que pretenen eliminar-nos com a poble és independitzar-nos-en. Del contrari sempre estarem a les seves mans perquè en facin el que vulguin de nosaltres i no ens volen, no volen la nostra existència, ni la nostra llengua, cultura, història i tradicions. Nomès volen explotar-nos econòmicament i prou. És per l’únic motiu que els castellans (autoproclamats espanyols per ocultar la seva invasió) han trepitjat mai Catalunya: per expoliar-la, per robar-la i la millor forma d’aconseguir-ho és manipulant la història i fer que els catalans s’oblidin que són catalans: és la millor garantia per a la seva explotació imperialista. Per això volen eliminar o reduir la llengua catalana tant com sigui possible, per això manipulen la història, per això minimitzen la llibertat de Catalunya que va ser més llarga que no pas l’actual ocupació espanyola.

  372. >>2012
    >>todavia siendo dominados por herramientas politicas como la “identidad nacional”.

  373. con gente como tu es con quién no queremos compartir un país. Qué te den porculo fascista de mierda

  374. Sin comentarios!! Esta persona, tiene mania a los nacionalistas, lo que no se dio cuenta, es que el también lo es, jejeje curioso 😉

  375. Lo que pasa es que el suscritor del artículo NO necesita ser nacionalista porque hay un Estado detrás (el español) que defiende su nación Española-Castellana. Los catalanes no gozamos de estado que defienda nuestra nación (recordemos que se tumbaron los artículos del Estatut en las que se defendía Cataluña como nación), por lo que los catalanes tenemos que reivindicar la nación Catalana por no estar jurídicamente protegida !!! Y por cierto está plagado de referencias a la Nación Catalana a lo largo de gran parte de la historia, dichas referencias desaparecen por arte de magia (censura castellana) en los XVIII-XIX, con los borbones, oh qué casualidad !!!

    Aquí unos ejemplos

    s. XVII

    “… los caballeros fueron tantos que no quedó casa en Cataluña, de la que no hubiera alguno, porque fue tal el primor y la atención fiel de aquella NACIÓN …”

    “…la conservó por dos siglos la NACIÓN catalana sobre todas las naciones del orbe.”

    “ … y esperar del valor marítimo de estas NACIONES con más abundancia de la CATALANA.”

    Pedro Abarca. Jaca.

    “ Si los catalanes se pusiesen en defensa, no faltaría hacer en su daño y castigo, acabando de una vez con el orgullo y la libertad de aquella NACIÓN”.

    “ Son los catalanes, aunque de ánimo recio, gente inclinada al culto divino … señaladamente entre todas las NACIONES de España”.

    “… por lo que entre las más NACIONES de España son amantes de la libertad”

    Francisco Manuel de Melo. Hispano-portugués. S XVII

    “de allí adelante comenzó la NACIÓN catalana a ser estimada sobre todas en las empresas del mar”.

    “propuso otra cosa en nombre de aquel Principado, como de NACIÓN muy prevenida y atenta en la conservación de sus Constituciones y costumbres”.

    “… porqué el gran nombre de la NACIÓN catalana, que tan preciado y ensalzado era generalmente por todo el mundo.”

    “Tenía la NACIÓN catalana en aquellos tiempos muy grande contratación con África, Grecia, Rumania, Próximo Oriente …”

    Zurita. Zaragoza. (s.XVI)

    Alguna referencia la nación española o castellana anterior al XVIII-XIX ???

    Luego me vienen que con lo de que lo único que prevalece es la Nación forjada en el XIX !! Y un comino !!

  376. VISCA CATALUNYA ! !!!! MERDA ESPANYA !!!!!!! espanyols cabrons !!!!!

  377. volaltres si que sou una merda

  378. Cap problema, nen. En breu podràs gaudir de tota la teva Escanya per a tu solet i només en castellà.

    Apa, siau Escanya!

  379. Trobo insultant el títol d’aquest post i dedueixo automàticament que l’autor és una persona plena d’odi i ignorància.El Diguem no” d’en Raimon no era en contra de ningú, sinó en defensa del poble català que estava oprimit per Espanya. L’invasor ha estat el poble de Castella, no pas Catalunya. Catalunya només s’ha defensat dels estrangers que l’han envaïda. Això ho pot entendre qualsevol nen. Si l’autor del post congues la veritable història d’Espanya s’avergonyiria de tot el que ha dit. “Espanya es va construir gràcies a Catalunya, fins i tot la bandera espanyola és una copia d’una de les banderes catalanes, en concret de la bandera mercant catalana que utilitzaven els vaixells catalans durant la descoberta d’Amèrica, que per cert va ser protagonitzada exclusivament per catalans com s’està demostrant. Els colors groc i vermell sempre han estat colors catalans. Per tant la bandera espanyola te els colors de Catalunya. Quin ridícul que feu. La nostra senyera (bandera) és mil·lenaria mentre que la bandera espanyola te només uns pocs anys. Espanya és un invent dels nacionalistes castellans que han volgut sotmetre els seus pobles veïns.Castella no va respectar les constitucions catalanes. Castella ens va enganyar i ens segueix enganyant, sou un poble imperialista, inquisidor, egoista, i en definitiva pobre d’esperit. Només us heu dedicat els seus esforços a censurar, a enganyar, a viure dels demés. Us sobra prepotencia i us falta intel·ligència. Spain is pain, ja ho diu l’ultim economist. Ells ho descobreixen ara, nosaltres ho sabem des de fa 500 anys. Ni tant sols existeix el siglo de oro de la literatura espanyola. Tot això es destaparà i aleshores fareu el ridícul. Ja l’esteu fent des de fa molt temps. Els que us creieu espanyols us adonareu que precisament sou vosaltres els qui no sou cap nació, i que gairebé tot el que creieu que era vostre, era robat. Finalment resultarà que tot allò de que ens acusaveu, era justament la vostra falta. La gran majoria d’obres, començant per Cervantes son obres catalanes mal traduïdes al castellà de les quals es van fer desaparèixer les versions originals. Tirant lo blanc és un exemple, fins fa poc era Tirante el blanco, un “clássico de la literatura española”, fins que es va trobar el llibre original. Aneu-vos preparant colla de prepotents. El nostre imne ho deixa clar: Endarere aquesta gent tant ufana i tant superba. Es refereix a vosaltres, espanyols. Adéu.

  380. “…català de Xàtiva…” (catalán de Jávea) dice el adicinarit este, jajajajaja. ¡Menudo tonto a las 3 con lo justito para terminar el día!

  381. Alguien ha oido la notícia??? estudiosos alemanes encuentran textos en el que se afirma que el castellano proviene del català???
    El estudio “Der Ursprung des Spanischen” realizado por el Romanistische Abteilung de la Universidad de Friburgo dice demostrar que el origen de la lengua castellana es el catalán.

    El grupo de lingüistas e historiadores alemanes descubrieron en la Biblioteca Vaticana una serie de textos de mediados del siglo IX dC. donde escribanos de la corte de Ramón IV discutían la fuerte influencia que estaba ejerciendo el catalán sobre el castellano “las gents de la castella usen ja nosos vocablas”, “la gente de castilla ya usa nuestras palabras” se puede leer en el texto de uno de los escribanos. A mediados del siglo IX la influencia catalana sobre el resto de la península creció de forma muy notoria. La gran influencia económica y social que los catalanes ejercieron tuvo que dejar huella.
    “La preponderancia de la cultura catalana, y su mayor grado de desarrollo supuso en las zonas de contacto y superposición un fenómeno de asimilación de los rasgos culturales” declaraba Mark Vlamynck, historiador del Romanistische Abteilung.

    Este estudio se terminó en enero del 2003, está siendo muy poco publicitado por las grandes presiones políticas que genera.
    Va vinga……i ara xarreu. Ignorants. Si el català és una merda…. el castellà és el pet!

  382. On collons para el moderador d’aquest merda blog? Sapigues que et queda poc temps en aquest estimat país. Gent com tu sera repatriada o directament sodomitzada en nom de Catalunya i en nom del Molt honorable penis del senyor Mas.

  383. Los nazis (yo no los llamo nazionalistas, sino directamente NAZIS, que es lo que son) son como la izquierda: La democracia (como la república en su momento) no es un fin en si mismo para ellos, sino un medio para imponer su dictadura. La Historia se repite… y se repite… y se repite.., hasta que aprendamos. ¿Será posible que este país no viva sin una guerrra civil cada siglo???

  384. NO TE ROM_PO la cara, porque NO TETENGO DELANTE; payasete.

    Visca la independència.

    Ah!!!!! Y quedate con los politicos que .. .. . . .. . … roban y hacen PEINETAS. ja j a ja
    Un beso PAYASETE jua ju a jua

  385. Xé, que tenim per ací, parlaré en castella per a que m’entenguen els porcs aquestos que mes que parlar una llengüa pareix que lladren.
    Haver como español soy bilingüe, impuesto por Franco y sus seguidores retrasados que me obligaron a hablar y escribir de esta manera, la cual me está dando asco a mi mismo, y solo para decir que los castellanos solo existen por una idea estúpida aportada por un inútil como era francisco franco(para amigos paco) y que ojala que antes de crear esta lengüa le hubiera atropellado un coche o hubiera tenido un accidente en avión como sus antecesores.
    Me despido.

  386. These are really great ideas in regarding blogging.
    You have touched some pleasant points here.
    Any way keep up wrinting.

  387. Have you ever considered creating an e-book or guest authoring on
    other sites? I have a blog based upon on the same topics you discuss
    and would really like to have you share some stories/information.

    I know my viewers would value your work. If you are even remotely interested, feel free
    to send me an email.

  388. If some one desires expert view on the topic of blogging and site-building afterward i
    propose him/her to pay a visit this weblog, Keep
    up the pleasant work.

  389. I’m really impressed along with your writing talents as smartly as with the format for your blog. Is this a paid subject matter or did you modify it yourself? Either way stay up the excellent high quality writing, it’s
    uncommon to peer a great weblog like this one today..

  390. Very nice write-up. I definitely appreciate this site.

  391. Hello! Do you know if they make any plugins to assist with SEO?
    I’m trying to get my blog to rank for some targeted keywords but I’m
    not seeing very good success. If you know of any please share.
    Many thanks!

  392. Catalunya //*//

    • Que exagerado eres Libertad tambin es crecer como pueblo y querer regirse como tal. No hay ninguna contradiccin entre los artculos de la Constitucin y la peticin en clave independentista Mas bien es el resultado de ejercer la Democracia Lo que esta claro es que en este pas si no planteamos las cosas en plan bronca no hay audiencia Yo como catalan viejo entiendo la ilusin de muchos independentistas aunque no la comparto Despus del fracaso de la izquierda hay mucha gente hurfana de ilusiones colectivas.Si sumas a esto que se ha desarrollado una cultura catalana como nunca y que tenemos casi 300 mil funcionarios que llevan aos disputandose competencias con el estado central empezaras a entender algo

  393. You really make it seem so easy with your presentation but
    I find this matter to be actually something which I think I would
    never understand. It seems too complex and extremely broad
    for me. I am looking forward for your next post,
    I’ll try to get the hang of it!

  394. Hello! Do you use Twitter? I’d like to follow you if that would be ok.
    I’m undoubtedly enjoying your blog andd look forward to
    new updates.

  395. I could not resst commenting. Very well written!

  396. Do you have a spam problem on this blog; I also am a blogger, and I was
    curious about your situation; many of us have developed some nice methods and we are looking to swap strategies with others, why not shoot me an e-mail if interested.

  397. My partner and I absolutely love your blog and find almost
    all of your post’s to be just what I’m looking for. can you offer guest writers to write content for you
    personally? I wouldn’t mind publishing a post or elaborating on some of the subjects you write with regards to here.

    Again, awesome weblog!

  398. I have read so many content on the topic of the blogger lovers except this paragraph is really a pleasant article, keep it up.

  399. There is definately a lot to find out about this topic.
    I really like all the points you’ve made.

  400. haber flipado de mierda vete a dar una vuelta hombre que miras a los catalanes y a la lengua como una mierda i somos todos iguales eh no sé que te flipas persona extraterrestre por que te digo yo que no eres una persona normal seguro que tienes algún problema en el cráneo ve al medico y me agradecerás, y que sepas que no tienes ni un poco de razón, por que todas las lenguas del mundo son igual de importantes y para que tu ahora digas k el catalán es una mierda pues como te he dicho tienes de ir al medico urgentemente por que estas mal de la cabeza y también tenéis a los catalanes como si fuéramos menos y no lo encuentro bien por que todos somos iguales de importantes en el mundo y decir que el catalán es una mierda es ser un chulo de mierda.

  401. Thank you for some other informative site. Where else may just I get that kind of information written in such an ideal manner?

    I have a challenge that I’m just now running on,
    and I’ve been at the look out for such info.

  402. Excelente articulo, muchas gracias

  403. ¿¿¿Pero esto que es???
    Si no te gusta el catalán pues te jodes, ¡¡¡tampoco te han echo nada!!!
    Así que no te metas con ellos porque ellos no se meten contigo aun que podrían. 😒

  404. Tu si ke eres una puta mierda desgraciao

  405. Mas o menos resume tu articulo lo siguiente:
    “con lo bien atado que lo dejó franco y nosotros vamos y se lo desatamos, como me molaria volver a eso”. Porque obvias que antes de la guerra ya existia el “problema catalan” que se resolvio a cañonazos y el resumen de tu “pueblerina” manera de ver el mundo es que les dimós cancha a los nazionalistas catalanes: firmado un nazionalista español.
    Josep Plà ya lo decia: En España las izquierdas y las derechas se unen en su anticatalanismo


Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: